ID: 1073676746

View in Genome Browser
Species Human (GRCh38)
Location 10:105655782-105655804
Sequence CTGCAACAGCAAAAGCAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073676738_1073676746 26 Left 1073676738 10:105655733-105655755 CCATTGAGAGAGAGAAAACATCC No data
Right 1073676746 10:105655782-105655804 CTGCAACAGCAAAAGCAGAATGG No data
1073676740_1073676746 5 Left 1073676740 10:105655754-105655776 CCACACCAGGACATCTTATCAGG No data
Right 1073676746 10:105655782-105655804 CTGCAACAGCAAAAGCAGAATGG No data
1073676742_1073676746 0 Left 1073676742 10:105655759-105655781 CCAGGACATCTTATCAGGCCCCA No data
Right 1073676746 10:105655782-105655804 CTGCAACAGCAAAAGCAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073676746 Original CRISPR CTGCAACAGCAAAAGCAGAA TGG Intergenic
No off target data available for this crispr