ID: 1073677103

View in Genome Browser
Species Human (GRCh38)
Location 10:105660824-105660846
Sequence CAGTAGTTCTTGAGCTTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073677097_1073677103 18 Left 1073677097 10:105660783-105660805 CCAAAAGGAAAAGATCTGGGGGC No data
Right 1073677103 10:105660824-105660846 CAGTAGTTCTTGAGCTTAGAGGG No data
1073677092_1073677103 25 Left 1073677092 10:105660776-105660798 CCTAGCACCAAAAGGAAAAGATC No data
Right 1073677103 10:105660824-105660846 CAGTAGTTCTTGAGCTTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073677103 Original CRISPR CAGTAGTTCTTGAGCTTAGA GGG Intergenic
No off target data available for this crispr