ID: 1073682498

View in Genome Browser
Species Human (GRCh38)
Location 10:105719421-105719443
Sequence ATTTTTCCACAGATGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073682484_1073682498 27 Left 1073682484 10:105719371-105719393 CCAGCAGAACCCAGCCTTTTTGG No data
Right 1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG No data
1073682491_1073682498 13 Left 1073682491 10:105719385-105719407 CCTTTTTGGCACCAGGGACTGGT 0: 487
1: 806
2: 1199
3: 1099
4: 765
Right 1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG No data
1073682488_1073682498 18 Left 1073682488 10:105719380-105719402 CCCAGCCTTTTTGGCACCAGGGA 0: 90
1: 1154
2: 1711
3: 1325
4: 910
Right 1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG No data
1073682489_1073682498 17 Left 1073682489 10:105719381-105719403 CCAGCCTTTTTGGCACCAGGGAC 0: 91
1: 1113
2: 1769
3: 1374
4: 958
Right 1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG No data
1073682493_1073682498 2 Left 1073682493 10:105719396-105719418 CCAGGGACTGGTTCCATGGAAGA 0: 5
1: 333
2: 579
3: 1200
4: 1388
Right 1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073682498 Original CRISPR ATTTTTCCACAGATGGAGGT GGG Intergenic
No off target data available for this crispr