ID: 1073683363

View in Genome Browser
Species Human (GRCh38)
Location 10:105728488-105728510
Sequence TACTTGCCCCCCAGGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073683363_1073683376 24 Left 1073683363 10:105728488-105728510 CCACCTCCCCTGGGGGGCAAGTA No data
Right 1073683376 10:105728535-105728557 TCTCTACCCTCTCTTTTCTTTGG No data
1073683363_1073683377 25 Left 1073683363 10:105728488-105728510 CCACCTCCCCTGGGGGGCAAGTA No data
Right 1073683377 10:105728536-105728558 CTCTACCCTCTCTTTTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073683363 Original CRISPR TACTTGCCCCCCAGGGGAGG TGG (reversed) Intergenic
No off target data available for this crispr