ID: 1073687337

View in Genome Browser
Species Human (GRCh38)
Location 10:105769756-105769778
Sequence CTCCTACTGGATTTTCTGTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073687337_1073687344 20 Left 1073687337 10:105769756-105769778 CCCGACAGAAAATCCAGTAGGAG No data
Right 1073687344 10:105769799-105769821 GAAAGGGAATAAGCCAAGCAAGG No data
1073687337_1073687343 4 Left 1073687337 10:105769756-105769778 CCCGACAGAAAATCCAGTAGGAG No data
Right 1073687343 10:105769783-105769805 GTGAAACAAACACAAGGAAAGGG No data
1073687337_1073687342 3 Left 1073687337 10:105769756-105769778 CCCGACAGAAAATCCAGTAGGAG No data
Right 1073687342 10:105769782-105769804 GGTGAAACAAACACAAGGAAAGG No data
1073687337_1073687341 -2 Left 1073687337 10:105769756-105769778 CCCGACAGAAAATCCAGTAGGAG No data
Right 1073687341 10:105769777-105769799 AGAGTGGTGAAACAAACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073687337 Original CRISPR CTCCTACTGGATTTTCTGTC GGG (reversed) Intergenic
No off target data available for this crispr