ID: 1073690414 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:105802018-105802040 |
Sequence | CAGAAGTGCCTCTAATAGCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1073690409_1073690414 | 15 | Left | 1073690409 | 10:105801980-105802002 | CCTCACAAGTTTTAGAAGTTGCC | No data | ||
Right | 1073690414 | 10:105802018-105802040 | CAGAAGTGCCTCTAATAGCTGGG | No data | ||||
1073690411_1073690414 | -6 | Left | 1073690411 | 10:105802001-105802023 | CCAGAAAAGGTACCTGTCAGAAG | No data | ||
Right | 1073690414 | 10:105802018-105802040 | CAGAAGTGCCTCTAATAGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1073690414 | Original CRISPR | CAGAAGTGCCTCTAATAGCT GGG | Intergenic | ||
No off target data available for this crispr |