ID: 1073690414

View in Genome Browser
Species Human (GRCh38)
Location 10:105802018-105802040
Sequence CAGAAGTGCCTCTAATAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073690409_1073690414 15 Left 1073690409 10:105801980-105802002 CCTCACAAGTTTTAGAAGTTGCC No data
Right 1073690414 10:105802018-105802040 CAGAAGTGCCTCTAATAGCTGGG No data
1073690411_1073690414 -6 Left 1073690411 10:105802001-105802023 CCAGAAAAGGTACCTGTCAGAAG No data
Right 1073690414 10:105802018-105802040 CAGAAGTGCCTCTAATAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073690414 Original CRISPR CAGAAGTGCCTCTAATAGCT GGG Intergenic
No off target data available for this crispr