ID: 1073692532

View in Genome Browser
Species Human (GRCh38)
Location 10:105826099-105826121
Sequence ACAATTTGAGAGTAGATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073692532_1073692533 -3 Left 1073692532 10:105826099-105826121 CCTGGGATCTACTCTCAAATTGT No data
Right 1073692533 10:105826119-105826141 TGTGCCTAAGTCTTTATCTCAGG No data
1073692532_1073692534 -2 Left 1073692532 10:105826099-105826121 CCTGGGATCTACTCTCAAATTGT No data
Right 1073692534 10:105826120-105826142 GTGCCTAAGTCTTTATCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073692532 Original CRISPR ACAATTTGAGAGTAGATCCC AGG (reversed) Intergenic
No off target data available for this crispr