ID: 1073693222

View in Genome Browser
Species Human (GRCh38)
Location 10:105834858-105834880
Sequence ACCCCACAACTCCCACAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073693222_1073693226 23 Left 1073693222 10:105834858-105834880 CCCATCTGTGGGAGTTGTGGGGT No data
Right 1073693226 10:105834904-105834926 GTCTCTCCAACATTCTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073693222 Original CRISPR ACCCCACAACTCCCACAGAT GGG (reversed) Intergenic
No off target data available for this crispr