ID: 1073708445

View in Genome Browser
Species Human (GRCh38)
Location 10:106013360-106013382
Sequence CTCACATATGTCCTCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073708440_1073708445 29 Left 1073708440 10:106013308-106013330 CCTTGTTAGGTTGAATATATTTG No data
Right 1073708445 10:106013360-106013382 CTCACATATGTCCTCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073708445 Original CRISPR CTCACATATGTCCTCAGACA TGG Intergenic
No off target data available for this crispr