ID: 1073715451

View in Genome Browser
Species Human (GRCh38)
Location 10:106101432-106101454
Sequence GGCAATAAAAATTAGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073715446_1073715451 -2 Left 1073715446 10:106101411-106101433 CCTTGAATGGTGTGGGACAATGG No data
Right 1073715451 10:106101432-106101454 GGCAATAAAAATTAGGAGGTGGG No data
1073715445_1073715451 -1 Left 1073715445 10:106101410-106101432 CCCTTGAATGGTGTGGGACAATG No data
Right 1073715451 10:106101432-106101454 GGCAATAAAAATTAGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073715451 Original CRISPR GGCAATAAAAATTAGGAGGT GGG Intergenic
No off target data available for this crispr