ID: 1073716070

View in Genome Browser
Species Human (GRCh38)
Location 10:106108850-106108872
Sequence GGGAGAGGTGGGCACTTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073716070_1073716079 6 Left 1073716070 10:106108850-106108872 CCTCACAAGTGCCCACCTCTCCC No data
Right 1073716079 10:106108879-106108901 CTCTTCCCTATTTATTAAGAGGG No data
1073716070_1073716083 23 Left 1073716070 10:106108850-106108872 CCTCACAAGTGCCCACCTCTCCC No data
Right 1073716083 10:106108896-106108918 AGAGGGTATTTTTATTAAGAGGG No data
1073716070_1073716082 22 Left 1073716070 10:106108850-106108872 CCTCACAAGTGCCCACCTCTCCC No data
Right 1073716082 10:106108895-106108917 AAGAGGGTATTTTTATTAAGAGG No data
1073716070_1073716078 5 Left 1073716070 10:106108850-106108872 CCTCACAAGTGCCCACCTCTCCC No data
Right 1073716078 10:106108878-106108900 CCTCTTCCCTATTTATTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073716070 Original CRISPR GGGAGAGGTGGGCACTTGTG AGG (reversed) Intergenic
No off target data available for this crispr