ID: 1073716075

View in Genome Browser
Species Human (GRCh38)
Location 10:106108871-106108893
Sequence ATAAATAGGGAAGAGGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073716075_1073716082 1 Left 1073716075 10:106108871-106108893 CCTTTTCCCTCTTCCCTATTTAT No data
Right 1073716082 10:106108895-106108917 AAGAGGGTATTTTTATTAAGAGG No data
1073716075_1073716083 2 Left 1073716075 10:106108871-106108893 CCTTTTCCCTCTTCCCTATTTAT No data
Right 1073716083 10:106108896-106108918 AGAGGGTATTTTTATTAAGAGGG No data
1073716075_1073716084 24 Left 1073716075 10:106108871-106108893 CCTTTTCCCTCTTCCCTATTTAT No data
Right 1073716084 10:106108918-106108940 GTATTTAAGCCTCAACCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073716075 Original CRISPR ATAAATAGGGAAGAGGGAAA AGG (reversed) Intergenic
No off target data available for this crispr