ID: 1073716079

View in Genome Browser
Species Human (GRCh38)
Location 10:106108879-106108901
Sequence CTCTTCCCTATTTATTAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073716069_1073716079 7 Left 1073716069 10:106108849-106108871 CCCTCACAAGTGCCCACCTCTCC No data
Right 1073716079 10:106108879-106108901 CTCTTCCCTATTTATTAAGAGGG No data
1073716066_1073716079 27 Left 1073716066 10:106108829-106108851 CCCTAAAAATCATTTGCTACCCC No data
Right 1073716079 10:106108879-106108901 CTCTTCCCTATTTATTAAGAGGG No data
1073716071_1073716079 -5 Left 1073716071 10:106108861-106108883 CCCACCTCTCCCTTTTCCCTCTT No data
Right 1073716079 10:106108879-106108901 CTCTTCCCTATTTATTAAGAGGG No data
1073716067_1073716079 26 Left 1073716067 10:106108830-106108852 CCTAAAAATCATTTGCTACCCCT No data
Right 1073716079 10:106108879-106108901 CTCTTCCCTATTTATTAAGAGGG No data
1073716068_1073716079 8 Left 1073716068 10:106108848-106108870 CCCCTCACAAGTGCCCACCTCTC No data
Right 1073716079 10:106108879-106108901 CTCTTCCCTATTTATTAAGAGGG No data
1073716070_1073716079 6 Left 1073716070 10:106108850-106108872 CCTCACAAGTGCCCACCTCTCCC No data
Right 1073716079 10:106108879-106108901 CTCTTCCCTATTTATTAAGAGGG No data
1073716072_1073716079 -6 Left 1073716072 10:106108862-106108884 CCACCTCTCCCTTTTCCCTCTTC No data
Right 1073716079 10:106108879-106108901 CTCTTCCCTATTTATTAAGAGGG No data
1073716073_1073716079 -9 Left 1073716073 10:106108865-106108887 CCTCTCCCTTTTCCCTCTTCCCT No data
Right 1073716079 10:106108879-106108901 CTCTTCCCTATTTATTAAGAGGG No data
1073716065_1073716079 28 Left 1073716065 10:106108828-106108850 CCCCTAAAAATCATTTGCTACCC No data
Right 1073716079 10:106108879-106108901 CTCTTCCCTATTTATTAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073716079 Original CRISPR CTCTTCCCTATTTATTAAGA GGG Intergenic
No off target data available for this crispr