ID: 1073716082

View in Genome Browser
Species Human (GRCh38)
Location 10:106108895-106108917
Sequence AAGAGGGTATTTTTATTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073716073_1073716082 7 Left 1073716073 10:106108865-106108887 CCTCTCCCTTTTCCCTCTTCCCT No data
Right 1073716082 10:106108895-106108917 AAGAGGGTATTTTTATTAAGAGG No data
1073716068_1073716082 24 Left 1073716068 10:106108848-106108870 CCCCTCACAAGTGCCCACCTCTC No data
Right 1073716082 10:106108895-106108917 AAGAGGGTATTTTTATTAAGAGG No data
1073716069_1073716082 23 Left 1073716069 10:106108849-106108871 CCCTCACAAGTGCCCACCTCTCC No data
Right 1073716082 10:106108895-106108917 AAGAGGGTATTTTTATTAAGAGG No data
1073716074_1073716082 2 Left 1073716074 10:106108870-106108892 CCCTTTTCCCTCTTCCCTATTTA No data
Right 1073716082 10:106108895-106108917 AAGAGGGTATTTTTATTAAGAGG No data
1073716076_1073716082 -5 Left 1073716076 10:106108877-106108899 CCCTCTTCCCTATTTATTAAGAG No data
Right 1073716082 10:106108895-106108917 AAGAGGGTATTTTTATTAAGAGG No data
1073716072_1073716082 10 Left 1073716072 10:106108862-106108884 CCACCTCTCCCTTTTCCCTCTTC No data
Right 1073716082 10:106108895-106108917 AAGAGGGTATTTTTATTAAGAGG No data
1073716070_1073716082 22 Left 1073716070 10:106108850-106108872 CCTCACAAGTGCCCACCTCTCCC No data
Right 1073716082 10:106108895-106108917 AAGAGGGTATTTTTATTAAGAGG No data
1073716075_1073716082 1 Left 1073716075 10:106108871-106108893 CCTTTTCCCTCTTCCCTATTTAT No data
Right 1073716082 10:106108895-106108917 AAGAGGGTATTTTTATTAAGAGG No data
1073716071_1073716082 11 Left 1073716071 10:106108861-106108883 CCCACCTCTCCCTTTTCCCTCTT No data
Right 1073716082 10:106108895-106108917 AAGAGGGTATTTTTATTAAGAGG No data
1073716077_1073716082 -6 Left 1073716077 10:106108878-106108900 CCTCTTCCCTATTTATTAAGAGG No data
Right 1073716082 10:106108895-106108917 AAGAGGGTATTTTTATTAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073716082 Original CRISPR AAGAGGGTATTTTTATTAAG AGG Intergenic
No off target data available for this crispr