ID: 1073716562

View in Genome Browser
Species Human (GRCh38)
Location 10:106114756-106114778
Sequence GCATCCAGCAGAGCAGCTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073716562_1073716571 10 Left 1073716562 10:106114756-106114778 CCGGTAGCTGCTCTGCTGGATGC No data
Right 1073716571 10:106114789-106114811 TACCAAGTCCCCAGGGGGAGGGG No data
1073716562_1073716565 2 Left 1073716562 10:106114756-106114778 CCGGTAGCTGCTCTGCTGGATGC No data
Right 1073716565 10:106114781-106114803 CCTAAGACTACCAAGTCCCCAGG No data
1073716562_1073716570 9 Left 1073716562 10:106114756-106114778 CCGGTAGCTGCTCTGCTGGATGC No data
Right 1073716570 10:106114788-106114810 CTACCAAGTCCCCAGGGGGAGGG No data
1073716562_1073716567 4 Left 1073716562 10:106114756-106114778 CCGGTAGCTGCTCTGCTGGATGC No data
Right 1073716567 10:106114783-106114805 TAAGACTACCAAGTCCCCAGGGG No data
1073716562_1073716566 3 Left 1073716562 10:106114756-106114778 CCGGTAGCTGCTCTGCTGGATGC No data
Right 1073716566 10:106114782-106114804 CTAAGACTACCAAGTCCCCAGGG No data
1073716562_1073716568 5 Left 1073716562 10:106114756-106114778 CCGGTAGCTGCTCTGCTGGATGC No data
Right 1073716568 10:106114784-106114806 AAGACTACCAAGTCCCCAGGGGG No data
1073716562_1073716569 8 Left 1073716562 10:106114756-106114778 CCGGTAGCTGCTCTGCTGGATGC No data
Right 1073716569 10:106114787-106114809 ACTACCAAGTCCCCAGGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073716562 Original CRISPR GCATCCAGCAGAGCAGCTAC CGG (reversed) Intergenic
No off target data available for this crispr