ID: 1073716566

View in Genome Browser
Species Human (GRCh38)
Location 10:106114782-106114804
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073716559_1073716566 10 Left 1073716559 10:106114749-106114771 CCGATTCCCGGTAGCTGCTCTGC No data
Right 1073716566 10:106114782-106114804 CTAAGACTACCAAGTCCCCAGGG No data
1073716561_1073716566 4 Left 1073716561 10:106114755-106114777 CCCGGTAGCTGCTCTGCTGGATG No data
Right 1073716566 10:106114782-106114804 CTAAGACTACCAAGTCCCCAGGG No data
1073716562_1073716566 3 Left 1073716562 10:106114756-106114778 CCGGTAGCTGCTCTGCTGGATGC No data
Right 1073716566 10:106114782-106114804 CTAAGACTACCAAGTCCCCAGGG No data
1073716557_1073716566 27 Left 1073716557 10:106114732-106114754 CCAAGCACAAAGCTGTGCCGATT No data
Right 1073716566 10:106114782-106114804 CTAAGACTACCAAGTCCCCAGGG No data
1073716556_1073716566 28 Left 1073716556 10:106114731-106114753 CCCAAGCACAAAGCTGTGCCGAT No data
Right 1073716566 10:106114782-106114804 CTAAGACTACCAAGTCCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073716566 Original CRISPR CTAAGACTACCAAGTCCCCA GGG Intergenic
No off target data available for this crispr