ID: 1073716571

View in Genome Browser
Species Human (GRCh38)
Location 10:106114789-106114811
Sequence TACCAAGTCCCCAGGGGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073716559_1073716571 17 Left 1073716559 10:106114749-106114771 CCGATTCCCGGTAGCTGCTCTGC No data
Right 1073716571 10:106114789-106114811 TACCAAGTCCCCAGGGGGAGGGG No data
1073716562_1073716571 10 Left 1073716562 10:106114756-106114778 CCGGTAGCTGCTCTGCTGGATGC No data
Right 1073716571 10:106114789-106114811 TACCAAGTCCCCAGGGGGAGGGG No data
1073716561_1073716571 11 Left 1073716561 10:106114755-106114777 CCCGGTAGCTGCTCTGCTGGATG No data
Right 1073716571 10:106114789-106114811 TACCAAGTCCCCAGGGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073716571 Original CRISPR TACCAAGTCCCCAGGGGGAG GGG Intergenic
No off target data available for this crispr