ID: 1073729834

View in Genome Browser
Species Human (GRCh38)
Location 10:106274347-106274369
Sequence CTGGGCCTATAGAGGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073729834_1073729844 23 Left 1073729834 10:106274347-106274369 CCTTTCTCCCTCTATAGGCCCAG No data
Right 1073729844 10:106274393-106274415 CTAACTTCTTTCTACTGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073729834 Original CRISPR CTGGGCCTATAGAGGGAGAA AGG (reversed) Intergenic
No off target data available for this crispr