ID: 1073730833

View in Genome Browser
Species Human (GRCh38)
Location 10:106285721-106285743
Sequence CTCTCTCTGCTCCCAGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073730833_1073730839 4 Left 1073730833 10:106285721-106285743 CCAGACACTGGGAGCAGAGAGAG No data
Right 1073730839 10:106285748-106285770 GTAGGGAGGAAGTTAGGTTTGGG No data
1073730833_1073730838 3 Left 1073730833 10:106285721-106285743 CCAGACACTGGGAGCAGAGAGAG No data
Right 1073730838 10:106285747-106285769 AGTAGGGAGGAAGTTAGGTTTGG No data
1073730833_1073730836 -10 Left 1073730833 10:106285721-106285743 CCAGACACTGGGAGCAGAGAGAG No data
Right 1073730836 10:106285734-106285756 GCAGAGAGAGACAAGTAGGGAGG No data
1073730833_1073730840 13 Left 1073730833 10:106285721-106285743 CCAGACACTGGGAGCAGAGAGAG No data
Right 1073730840 10:106285757-106285779 AAGTTAGGTTTGGGTAGTGCTGG No data
1073730833_1073730837 -2 Left 1073730833 10:106285721-106285743 CCAGACACTGGGAGCAGAGAGAG No data
Right 1073730837 10:106285742-106285764 AGACAAGTAGGGAGGAAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073730833 Original CRISPR CTCTCTCTGCTCCCAGTGTC TGG (reversed) Intergenic
No off target data available for this crispr