ID: 1073734522

View in Genome Browser
Species Human (GRCh38)
Location 10:106330558-106330580
Sequence TTTTGGGAGGGGAAGGTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073734514_1073734522 -8 Left 1073734514 10:106330543-106330565 CCTGTAATCCCAGCATTTTGGGA 0: 13221
1: 306476
2: 262600
3: 198956
4: 220194
Right 1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG No data
1073734510_1073734522 20 Left 1073734510 10:106330515-106330537 CCAAAAGGACCAGGTGCAGGCAC No data
Right 1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG No data
1073734511_1073734522 11 Left 1073734511 10:106330524-106330546 CCAGGTGCAGGCACTCATACCTG No data
Right 1073734522 10:106330558-106330580 TTTTGGGAGGGGAAGGTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073734522 Original CRISPR TTTTGGGAGGGGAAGGTGGA TGG Intergenic
No off target data available for this crispr