ID: 1073735248

View in Genome Browser
Species Human (GRCh38)
Location 10:106337469-106337491
Sequence CCTGATAGAAGCCATCCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073735248_1073735251 3 Left 1073735248 10:106337469-106337491 CCTCAAGGATGGCTTCTATCAGG No data
Right 1073735251 10:106337495-106337517 TTGATGATTGAAGAAAGGAATGG No data
1073735248_1073735250 -2 Left 1073735248 10:106337469-106337491 CCTCAAGGATGGCTTCTATCAGG No data
Right 1073735250 10:106337490-106337512 GGTGTTTGATGATTGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073735248 Original CRISPR CCTGATAGAAGCCATCCTTG AGG (reversed) Intergenic
No off target data available for this crispr