ID: 1073735250

View in Genome Browser
Species Human (GRCh38)
Location 10:106337490-106337512
Sequence GGTGTTTGATGATTGAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073735248_1073735250 -2 Left 1073735248 10:106337469-106337491 CCTCAAGGATGGCTTCTATCAGG No data
Right 1073735250 10:106337490-106337512 GGTGTTTGATGATTGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073735250 Original CRISPR GGTGTTTGATGATTGAAGAA AGG Intergenic
No off target data available for this crispr