ID: 1073735251

View in Genome Browser
Species Human (GRCh38)
Location 10:106337495-106337517
Sequence TTGATGATTGAAGAAAGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073735248_1073735251 3 Left 1073735248 10:106337469-106337491 CCTCAAGGATGGCTTCTATCAGG No data
Right 1073735251 10:106337495-106337517 TTGATGATTGAAGAAAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073735251 Original CRISPR TTGATGATTGAAGAAAGGAA TGG Intergenic
No off target data available for this crispr