ID: 1073740257

View in Genome Browser
Species Human (GRCh38)
Location 10:106398652-106398674
Sequence GGGATACTGGTCCGTGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073740257_1073740265 0 Left 1073740257 10:106398652-106398674 CCCAGGCCACGGACCAGTATCCC No data
Right 1073740265 10:106398675-106398697 TCTGTGGCCTGTTAGGAACCAGG No data
1073740257_1073740271 22 Left 1073740257 10:106398652-106398674 CCCAGGCCACGGACCAGTATCCC No data
Right 1073740271 10:106398697-106398719 GCCACATGGCAGGAGGTGAGTGG No data
1073740257_1073740268 12 Left 1073740257 10:106398652-106398674 CCCAGGCCACGGACCAGTATCCC No data
Right 1073740268 10:106398687-106398709 TAGGAACCAGGCCACATGGCAGG No data
1073740257_1073740267 8 Left 1073740257 10:106398652-106398674 CCCAGGCCACGGACCAGTATCCC No data
Right 1073740267 10:106398683-106398705 CTGTTAGGAACCAGGCCACATGG No data
1073740257_1073740262 -7 Left 1073740257 10:106398652-106398674 CCCAGGCCACGGACCAGTATCCC No data
Right 1073740262 10:106398668-106398690 GTATCCCTCTGTGGCCTGTTAGG No data
1073740257_1073740269 15 Left 1073740257 10:106398652-106398674 CCCAGGCCACGGACCAGTATCCC No data
Right 1073740269 10:106398690-106398712 GAACCAGGCCACATGGCAGGAGG No data
1073740257_1073740273 26 Left 1073740257 10:106398652-106398674 CCCAGGCCACGGACCAGTATCCC No data
Right 1073740273 10:106398701-106398723 CATGGCAGGAGGTGAGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073740257 Original CRISPR GGGATACTGGTCCGTGGCCT GGG (reversed) Intergenic