ID: 1073744795

View in Genome Browser
Species Human (GRCh38)
Location 10:106455498-106455520
Sequence TACTTACCATTTAAGTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073744792_1073744795 25 Left 1073744792 10:106455450-106455472 CCTTCTCTGATTAGTTCACAGTT No data
Right 1073744795 10:106455498-106455520 TACTTACCATTTAAGTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073744795 Original CRISPR TACTTACCATTTAAGTTCTG TGG Intergenic
No off target data available for this crispr