ID: 1073753428

View in Genome Browser
Species Human (GRCh38)
Location 10:106555752-106555774
Sequence CAGGCCCCTGCACTTCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073753428_1073753434 23 Left 1073753428 10:106555752-106555774 CCAGGAAGAAGTGCAGGGGCCTG No data
Right 1073753434 10:106555798-106555820 AGACAGGCAGGAGGCTAGTGTGG No data
1073753428_1073753435 27 Left 1073753428 10:106555752-106555774 CCAGGAAGAAGTGCAGGGGCCTG No data
Right 1073753435 10:106555802-106555824 AGGCAGGAGGCTAGTGTGGCTGG No data
1073753428_1073753433 14 Left 1073753428 10:106555752-106555774 CCAGGAAGAAGTGCAGGGGCCTG No data
Right 1073753433 10:106555789-106555811 TTCTCTAAAAGACAGGCAGGAGG No data
1073753428_1073753431 7 Left 1073753428 10:106555752-106555774 CCAGGAAGAAGTGCAGGGGCCTG No data
Right 1073753431 10:106555782-106555804 AGTGCACTTCTCTAAAAGACAGG No data
1073753428_1073753432 11 Left 1073753428 10:106555752-106555774 CCAGGAAGAAGTGCAGGGGCCTG No data
Right 1073753432 10:106555786-106555808 CACTTCTCTAAAAGACAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073753428 Original CRISPR CAGGCCCCTGCACTTCTTCC TGG (reversed) Intergenic
No off target data available for this crispr