ID: 1073757265

View in Genome Browser
Species Human (GRCh38)
Location 10:106593901-106593923
Sequence GGAAGCAGGACTAAGACTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073757265_1073757269 17 Left 1073757265 10:106593901-106593923 CCAGGAGTCTTAGTCCTGCTTCC 0: 1
1: 0
2: 1
3: 17
4: 192
Right 1073757269 10:106593941-106593963 AAAAAACTACAAACATGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073757265 Original CRISPR GGAAGCAGGACTAAGACTCC TGG (reversed) Intronic
900523646 1:3117858-3117880 GAATGCAGGACAAAGGCTCCAGG + Intronic
901908197 1:12432888-12432910 AGAAGGAGGACTCAGACGCCAGG - Intronic
902299506 1:15491910-15491932 GGAAGCATGGCTAGGACTCAGGG + Intronic
902662650 1:17915897-17915919 GGAAGCAGAACGGAGAATCCTGG - Intergenic
902671133 1:17974644-17974666 GGAGGCAGAACTAAAACTGCTGG + Intergenic
904120153 1:28192934-28192956 GGAAGCAGCACTGAGACAGCTGG + Intronic
906206082 1:43987165-43987187 TGAAACAGGACCAAGGCTCCTGG - Intronic
906681039 1:47725523-47725545 GGAAGGAGGCCTGAGACTCCAGG - Intergenic
906954342 1:50359615-50359637 GGAGGAAAGACTAAGACTGCTGG - Intergenic
909115925 1:71536398-71536420 GGGAGCAGGCCTAAGATTCCCGG - Intronic
917782363 1:178411862-178411884 GGAAATAGGACCAAGACCCCTGG + Intronic
919848092 1:201654277-201654299 GGTAGCAGGACCAAGTCACCTGG + Intronic
920053391 1:203176408-203176430 GGAAGGGGCACTAAGTCTCCTGG + Intergenic
920163930 1:204021738-204021760 GGAAACAGAAGTAAGATTCCTGG - Intergenic
920530166 1:206695955-206695977 GGAAGTAGAACCAAGACCCCTGG - Intronic
920563663 1:206957336-206957358 GAAGGCAGGACTAAGCCTTCTGG + Intergenic
923122754 1:231008769-231008791 GAAAGAAAGAGTAAGACTCCAGG + Intergenic
923372562 1:233327977-233327999 GGAAGCTGGGCTCAGCCTCCCGG - Exonic
924607892 1:245550946-245550968 GGAAGCAGGACAAAGGGCCCTGG + Intronic
924712982 1:246545959-246545981 GGATGTTGGCCTAAGACTCCTGG - Intronic
1064527745 10:16275683-16275705 GGCAGAAGACCTAAGACTCCTGG + Intergenic
1068164775 10:53315095-53315117 GGCAGAAGGCCCAAGACTCCTGG - Intergenic
1068800320 10:61132966-61132988 GGAGGCAGGGCTTAGACTACAGG + Intergenic
1069249618 10:66251942-66251964 GGAACCAGGATTTAAACTCCAGG + Intronic
1069795412 10:71048810-71048832 CGAAGCTGGGCTAAGTCTCCAGG - Intergenic
1070744152 10:78922688-78922710 CCCAGCAGGACTCAGACTCCTGG - Intergenic
1073757265 10:106593901-106593923 GGAAGCAGGACTAAGACTCCTGG - Intronic
1075275055 10:121085775-121085797 GGAGCCAGGACTAAAACCCCGGG - Intergenic
1076491534 10:130865025-130865047 TGCAGCAGGAGTGAGACTCCCGG + Intergenic
1076989153 11:260747-260769 TGAGGCAGGTCTCAGACTCCTGG - Intergenic
1077791859 11:5449689-5449711 GGAAGCAGGACTCAGGATACAGG + Intronic
1079993767 11:27273951-27273973 GGAGGCTGGTCTCAGACTCCTGG + Intergenic
1081785632 11:45744878-45744900 GGACTCAAGAGTAAGACTCCAGG + Intergenic
1083182527 11:60996427-60996449 GGAAGCTGGACTGGGATTCCTGG - Intronic
1084120467 11:67066120-67066142 GCAAGGAGGGCTCAGACTCCTGG - Intronic
1084767134 11:71319769-71319791 GGAGGGAGGGCCAAGACTCCTGG + Intergenic
1084920136 11:72462568-72462590 GGAAGAAGAACTAAGATTCTGGG - Intergenic
1086952702 11:92907482-92907504 GGAAGTAGGATTCAGGCTCCAGG + Intergenic
1087766380 11:102159633-102159655 GCAACCAGGACTGTGACTCCTGG - Intronic
1088358626 11:108968678-108968700 TGAAGCAGGACTTTGACTTCTGG - Intergenic
1090117068 11:123984731-123984753 GGAGGAAGGACTAAGTCTGCTGG + Intergenic
1091782141 12:3220650-3220672 GGCAGCAGGACTAAGCCTCCGGG - Intronic
1091952485 12:4606520-4606542 AGAGCCAGGACTAAGACCCCAGG - Intronic
1093959387 12:25255660-25255682 GGAAGCAAGATTAAGTCTCCGGG - Intergenic
1098018584 12:66131930-66131952 GGAAGCATGCCTAAGAAACCTGG + Intronic
1099573310 12:84353122-84353144 TGAAGAAGAACTAATACTCCTGG - Intergenic
1100104057 12:91146961-91146983 GGAAGCAGGAATAATAATCAGGG - Intronic
1102673077 12:114636601-114636623 TGAAGCAGGACTTTAACTCCTGG - Intergenic
1103004314 12:117409103-117409125 GCAAGTAGGTCTAAGACTCAGGG - Intronic
1113637054 13:111926858-111926880 GGAAAGAGGGGTAAGACTCCAGG + Intergenic
1114582905 14:23780497-23780519 GGAAGCAGACCTAAGAGTCTGGG + Intergenic
1118481759 14:66174505-66174527 GCAGCCAGGACCAAGACTCCGGG + Intergenic
1119905377 14:78297454-78297476 GGAAGCAGACTTAAGACGCCAGG - Intronic
1120310294 14:82818305-82818327 GGAAACAGGAATAAGAGTTCAGG + Intergenic
1121443370 14:93962987-93963009 GGAAAGAGTACGAAGACTCCAGG - Intronic
1124100526 15:26688954-26688976 TAAAGCAGGAATAACACTCCTGG + Intronic
1124264789 15:28222853-28222875 GGAAGCTGGATAGAGACTCCAGG - Intronic
1124508258 15:30297779-30297801 AGAAGCCTGACAAAGACTCCCGG - Intergenic
1125008552 15:34845243-34845265 GGCAGAAGGCATAAGACTCCTGG - Intergenic
1126257275 15:46642753-46642775 GGAAGCAAAAGTAAGACTCACGG - Intergenic
1127707055 15:61557667-61557689 GGATACAGTAGTAAGACTCCTGG - Intergenic
1129827319 15:78642126-78642148 GAAAGCAAGACTGAGAGTCCTGG - Intronic
1130355343 15:83124911-83124933 GGAAGCAGGTCCAGGGCTCCAGG - Intronic
1132311858 15:100863044-100863066 GGAGTTAGGACAAAGACTCCTGG + Intergenic
1134094501 16:11410817-11410839 GGAACCTGGCCTAAGACTACTGG + Intronic
1134101444 16:11454939-11454961 TGGAGCAGGACTCAGGCTCCAGG + Intronic
1139076882 16:63462169-63462191 AGAAACAGGACTAAAACTCAAGG - Intergenic
1140257683 16:73350875-73350897 GGAAGCAGAACTCAGGCTCTGGG - Intergenic
1142716342 17:1748908-1748930 GGCAGGAGGACTGAGGCTCCAGG + Intronic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148463577 17:47851461-47851483 GGACGCAGGACTAAGACCCAGGG + Intronic
1149611761 17:57962590-57962612 GGAAGCAGGGCTGAGCCTCTGGG + Intergenic
1150069578 17:62139721-62139743 GGAGGCAGGACCAGGACGCCGGG - Intergenic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1152891953 17:82887091-82887113 GGAAGAAGGAATAAGACTGGTGG - Intronic
1153103474 18:1500779-1500801 GGAAGCAGAACTAACACTTTGGG + Intergenic
1153729402 18:7993582-7993604 GAAAGCAAGAAAAAGACTCCTGG + Intronic
1155185316 18:23382464-23382486 GGAAGCAGGCCTGAGACACGGGG + Intronic
1155867239 18:30981076-30981098 GGAAGCTGGGGTAAGACTCTGGG + Intergenic
1157763041 18:50278395-50278417 GGTAGGAGGGGTAAGACTCCTGG - Intronic
1160727771 19:625135-625157 GGAGGCAGGACCAGGACGCCGGG - Exonic
1161496594 19:4589833-4589855 GGAAGCAGAACTGAGCCTCGGGG + Intergenic
1162078711 19:8206091-8206113 GGAAGCTGGAGGAAGACACCTGG - Intronic
1163002633 19:14378152-14378174 GTCAGCAGGACTGAGACTTCAGG + Intergenic
1163064163 19:14780940-14780962 GTCAGCAGGACTGAGACTTCTGG - Intergenic
1166214111 19:41324664-41324686 GGAAGCAGCAGCTAGACTCCAGG + Exonic
1167780293 19:51594574-51594596 GGCGGAAGGACTACGACTCCCGG - Intergenic
1168342813 19:55635412-55635434 GGAGGCAGGACCCAGACTGCAGG + Intronic
925286067 2:2716518-2716540 GGAAGCAAGAGTAAGAATCCGGG + Intergenic
925349658 2:3191947-3191969 GGTAGCAGGGCGGAGACTCCAGG - Intronic
930112781 2:47693279-47693301 CTAAGCTGGACTAAAACTCCTGG + Intergenic
931238557 2:60432665-60432687 GGATTCAGGACCAAGACTCCCGG - Intergenic
932368412 2:71167541-71167563 GAAAGCAAGACTGAGAGTCCTGG - Intergenic
934153259 2:89170687-89170709 GGAAGCAGAAGTATGACTCATGG - Intergenic
934213977 2:90011244-90011266 GGAAGCAGAAGTATGACTCATGG + Intergenic
939986169 2:148831782-148831804 GGCAGCTGGACTCAGAATCCAGG + Intergenic
941783769 2:169477095-169477117 GGAAGCAGGTATGAGAATCCTGG - Intergenic
942810844 2:179998863-179998885 GGAACCGGGTGTAAGACTCCAGG - Intronic
942998042 2:182288970-182288992 GCAGTCAGGACTAGGACTCCAGG + Intronic
943247469 2:185473686-185473708 GGACGCAGGACAAAAACTCAGGG + Intergenic
943265135 2:185720837-185720859 TGAGGCTGGACTAAAACTCCTGG + Intergenic
945969639 2:216223114-216223136 GAAAGAAGGACTCAGACTCTGGG - Intergenic
946860726 2:223998050-223998072 TGAAGCATGAGTTAGACTCCAGG - Intronic
948212827 2:236207694-236207716 GGTAGCAGGAAGAAGCCTCCAGG - Intronic
1169210059 20:3760781-3760803 GGAGGCAGGCCTGAGACTCAGGG - Intronic
1170912412 20:20586312-20586334 GGCAAGAGGACCAAGACTCCAGG + Intronic
1172358606 20:34296723-34296745 TTCAGCAGGTCTAAGACTCCTGG + Intronic
1174806735 20:53610166-53610188 GGATGCAGCAATAACACTCCTGG + Intergenic
1175239765 20:57538490-57538512 GGAAGCAGCACCGAGAGTCCAGG + Intergenic
1176024477 20:62978728-62978750 CGAAGCAGAACTGAGACTCAGGG - Intergenic
1179884494 21:44307749-44307771 GGAAGCAGGTCTCAGAGCCCTGG + Intronic
1182800259 22:33026393-33026415 GCCACCAGGACTAAGGCTCCTGG + Intronic
1182866412 22:33608054-33608076 GGCAGCAGGACAAAGTCACCAGG + Intronic
1185030835 22:48442100-48442122 GGGCTCAGGACTCAGACTCCTGG - Intergenic
950445471 3:13034998-13035020 GAAAGCAGGACAGAGCCTCCAGG - Intronic
950447766 3:13048019-13048041 GGAGGCAGGACCCAGGCTCCTGG - Intronic
950957185 3:17066319-17066341 GGAAGTAGGACCATGGCTCCTGG + Intronic
954536387 3:51362282-51362304 GGAAGCAGGGCTAAGCCAACAGG - Intronic
954659263 3:52218225-52218247 GGGAGCAGGACCAGGGCTCCTGG - Intergenic
955137944 3:56238488-56238510 GGAACCACGCCCAAGACTCCTGG - Intronic
955764394 3:62326084-62326106 GTAAGCTGGACAAACACTCCGGG + Intronic
956355447 3:68387181-68387203 GAAAGCAGGACTAAAAGTTCTGG + Intronic
959515532 3:107262562-107262584 GGAAGAAGGCTCAAGACTCCTGG + Intergenic
959598130 3:108149933-108149955 AAAAGCAGGCCAAAGACTCCTGG - Intergenic
961552403 3:127676854-127676876 GGCTGCAGGACTAGGACTCCTGG - Intronic
962811110 3:138960384-138960406 GGCTGCAGGACAAAGACTGCGGG + Intergenic
962839327 3:139219683-139219705 GTAAGCAGGACTAAGAGGCATGG - Intronic
963429629 3:145181833-145181855 TTTAGCAGGACTAAGTCTCCTGG + Intergenic
964007725 3:151851868-151851890 GGAGGAAAGACTAAGTCTCCTGG + Intergenic
964641366 3:158913313-158913335 TTTAGCAGGACTAAGTCTCCTGG + Intergenic
966928725 3:184662142-184662164 AGAATCAGGACTAACATTCCAGG + Intronic
967574679 3:191076584-191076606 TGAGACAGGACTAAGCCTCCAGG + Intergenic
967795262 3:193592732-193592754 AGAAGCAGGACGAAGAGTCATGG - Intronic
968848793 4:3063554-3063576 TGGGGCAGGACAAAGACTCCTGG + Intergenic
969168372 4:5337899-5337921 GGAAGGATGACTAAGTCTCCTGG + Intronic
972319725 4:37962411-37962433 GGAAGCAGGGTTAAGACCCAGGG - Intronic
975267804 4:72391704-72391726 GGAAGCAGGACTAGAAAACCAGG + Intronic
976577388 4:86689897-86689919 GGAAGAGGGACCAACACTCCAGG - Intronic
977326984 4:95586432-95586454 TGAAGCTGGTCTCAGACTCCTGG + Intergenic
977638279 4:99326117-99326139 GGAAGTAAGTCAAAGACTCCAGG - Intergenic
979673613 4:123386778-123386800 TGAGGCAGGACTATGAGTCCTGG + Intergenic
983502662 4:168517095-168517117 GGAAGCAGGATCAAGACACAGGG + Intronic
983914949 4:173281936-173281958 GGATGCAGGACAAAGAACCCCGG - Intronic
983915805 4:173289342-173289364 GGACGCAGGACAAAGAAGCCAGG - Intronic
984047008 4:174813993-174814015 GGAATCAGGACAAAGGCTTCTGG + Intronic
984416192 4:179461003-179461025 GGCAGCAGGGCTAATATTCCAGG - Intergenic
985772374 5:1820908-1820930 GGAAGCTGGAGTGAGACTCTGGG + Intergenic
988990028 5:36661657-36661679 TGAAGCAGGAGTGTGACTCCAGG - Intronic
992392555 5:76342357-76342379 GGAAGCAGGACTCCTTCTCCTGG - Intronic
995016246 5:107312952-107312974 GGTAGCAGGACTGAGAACCCAGG + Intergenic
995230705 5:109758922-109758944 GGAAACAGAACTGAGAGTCCAGG - Intronic
995852714 5:116562862-116562884 GGAAATAGGACAAAGACTCCTGG + Intronic
996388247 5:122932426-122932448 TGAAGCTGGACTCAAACTCCTGG - Intronic
997557795 5:134816003-134816025 GGAAGAAGGACTATAACTCAAGG - Intronic
998157982 5:139796848-139796870 GGAAGAGGGCCTAAGACTCCTGG + Intronic
1000130430 5:158291766-158291788 GGAAGAAGGGAGAAGACTCCAGG + Intergenic
1001699374 5:173695755-173695777 GGCAGCAGGATTCAGACTCAGGG + Intergenic
1003099460 6:3165893-3165915 GGAAGCAGGACGAAGAGGCTAGG + Intergenic
1004141338 6:13020614-13020636 GGAAGCAGGACAAAGACCAAGGG + Intronic
1005817874 6:29571168-29571190 TCAAACAGGACTCAGACTCCAGG + Intronic
1006664063 6:35676860-35676882 GGAATCAGGCCCAAGACCCCTGG + Intronic
1008228647 6:48955599-48955621 GGAAGCACAATTATGACTCCAGG - Intergenic
1011525981 6:88265380-88265402 GGAAATAGGACCAAAACTCCTGG + Intergenic
1015571763 6:134629077-134629099 GGAAGCAGGAATAAAACTGGTGG + Intergenic
1018029669 6:159831918-159831940 GGAGGCAGGGCTCAGACACCGGG + Intergenic
1019854676 7:3592909-3592931 GGCAGGAGGACAAGGACTCCAGG - Intronic
1021483383 7:21142913-21142935 GGCTGCAGGAATAAGCCTCCAGG - Intergenic
1021518295 7:21510806-21510828 AGAAGCAGGACTTAAACTTCAGG + Intronic
1022623044 7:32004643-32004665 GGAAGATGGAGTAAGACACCTGG + Intronic
1027461207 7:78456137-78456159 GAAAGCAGAACTATGACTCCTGG - Intronic
1027827182 7:83130881-83130903 GGAAGCAAAATTATGACTCCAGG + Intronic
1029552484 7:101244835-101244857 GGAAGCCGAACTACGGCTCCCGG - Intronic
1030265826 7:107620977-107620999 GGAAGCAGGAGTGACACTGCAGG - Exonic
1032407268 7:131665706-131665728 GGAAATAGGACCAAGACCCCTGG + Intergenic
1033215840 7:139492955-139492977 GGCAGTAGCACTAAGACTGCGGG - Intergenic
1033690929 7:143736382-143736404 GGAAGCAGGTCTTACACTCAAGG + Intergenic
1033767421 7:144509050-144509072 GGAAGCAGGAATGAGCATCCTGG - Intronic
1035119015 7:156549412-156549434 GGAAGCAGCAAGAAGACACCAGG + Intergenic
1035616891 8:1008832-1008854 GGAATCAGGACTAGGAGGCCCGG - Intergenic
1037438878 8:18893690-18893712 GGAAGCAGGATCAGAACTCCAGG + Intronic
1037760312 8:21737639-21737661 GGAGGCAGGACTGAGCCTCCTGG - Intronic
1038254496 8:25938712-25938734 GAACCCTGGACTAAGACTCCAGG + Intronic
1041985550 8:63918296-63918318 GAAAGCAGGACTGAGAGTGCTGG - Intergenic
1044135840 8:88584644-88584666 GGAAGAAAGACTAAGTCTGCTGG + Intergenic
1044420855 8:91994149-91994171 GGGAGCAGCATTAGGACTCCTGG - Intronic
1045179560 8:99765506-99765528 GGCAGAAGGAATAAGACTCCTGG + Intronic
1049135197 8:140891785-140891807 GGAAACAGGAATAAGACTTCAGG + Intronic
1049574216 8:143382995-143383017 GGAGGCAGGACTGAGACCTCAGG - Exonic
1049814433 8:144591566-144591588 GGGAGCAGGATGAAGGCTCCGGG + Intronic
1052582871 9:30383637-30383659 GGAAGCAGGCCAAAGAATACAGG + Intergenic
1052664697 9:31480014-31480036 GGAAACAGGACTAAGATCCCTGG + Intergenic
1052921009 9:33969335-33969357 GGAAGCTGGTCTTAAACTCCTGG - Intronic
1055384246 9:75743916-75743938 GAAAGCAGGAATAATACTCCTGG - Intergenic
1055472278 9:76624353-76624375 GGAAGCAGGAATAAAACACCAGG + Intronic
1055621823 9:78133935-78133957 GGAAGGATGACTCAGACCCCTGG + Intergenic
1057164407 9:92914679-92914701 GGGAGCTGGAGTAAGAGTCCTGG - Intergenic
1057722947 9:97547307-97547329 GGCAGCAGGACCAGCACTCCAGG - Intronic
1058749415 9:108024265-108024287 GGAATGAGCAGTAAGACTCCTGG - Intergenic
1061932690 9:133841431-133841453 GGAAACAGGGCCAGGACTCCAGG - Intronic
1062722564 9:138052002-138052024 GGGAGCAGGACTCAGACCCTGGG + Intronic
1186677602 X:11835428-11835450 GGCAGCAGGACTAAGAGAACAGG + Intergenic
1191741011 X:64434960-64434982 GGAAGCAGGGCAGAGGCTCCAGG - Intergenic
1191903674 X:66064852-66064874 GGAAGCAGCACAAAGGCTCTGGG - Intergenic
1194133113 X:90106347-90106369 GGAGGAAAGACTAAGTCTCCTGG + Intergenic
1195942516 X:110177790-110177812 GGAAGCAAGGCCAGGACTCCTGG - Intronic
1196411525 X:115424979-115425001 GGATGCAGGGATAGGACTCCAGG + Intergenic
1196755918 X:119157154-119157176 GGAAGCAGGACAGAGACTTTGGG - Intergenic
1198050984 X:132953489-132953511 GGAAGCAGGATTCAGAGTCTTGG + Intronic
1199219157 X:145297171-145297193 GGAAGCAGGACGTAGAGTCAAGG - Intergenic
1200478900 Y:3676422-3676444 GGAGGAAAGACTAAGTCTCCTGG + Intergenic