ID: 1073767195

View in Genome Browser
Species Human (GRCh38)
Location 10:106695648-106695670
Sequence ACACCATGCCTGGCATAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073767188_1073767195 26 Left 1073767188 10:106695599-106695621 CCTACCTCATAATGTATGTACTG 0: 1
1: 0
2: 1
3: 12
4: 121
Right 1073767195 10:106695648-106695670 ACACCATGCCTGGCATAAAGTGG No data
1073767187_1073767195 27 Left 1073767187 10:106695598-106695620 CCCTACCTCATAATGTATGTACT 0: 1
1: 0
2: 1
3: 14
4: 153
Right 1073767195 10:106695648-106695670 ACACCATGCCTGGCATAAAGTGG No data
1073767189_1073767195 22 Left 1073767189 10:106695603-106695625 CCTCATAATGTATGTACTGAATG 0: 1
1: 0
2: 3
3: 9
4: 155
Right 1073767195 10:106695648-106695670 ACACCATGCCTGGCATAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073767195 Original CRISPR ACACCATGCCTGGCATAAAG TGG Intronic
No off target data available for this crispr