ID: 1073767892

View in Genome Browser
Species Human (GRCh38)
Location 10:106703512-106703534
Sequence CCATTGCCATTAAGAGCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073767892 Original CRISPR CCATTGCCATTAAGAGCATG TGG (reversed) Intronic
900040138 1:454264-454286 CAATTGCCATTAAGAACAGGTGG + Intergenic
900061567 1:689238-689260 CGATTGCCATTAAGAACAGGTGG + Intergenic
900392506 1:2439881-2439903 CCCTTCACATTAAGATCATGAGG - Intronic
901929138 1:12585780-12585802 CCAAGGCCATCATGAGCATGAGG + Intronic
902854311 1:19189181-19189203 CCATTGTCAAAGAGAGCATGGGG + Intronic
905293332 1:36938322-36938344 ACATTCCCATAAAAAGCATGAGG + Intronic
905329839 1:37186861-37186883 GCAATGTCATAAAGAGCATGAGG + Intergenic
907764877 1:57399169-57399191 GCAATGCCATTAAGAGCAACTGG + Intronic
908261855 1:62345263-62345285 GCATTGCCGTTAAGAGCAGATGG + Intergenic
908931742 1:69324727-69324749 CCATTGCTTTCAATAGCATGAGG + Intergenic
913349160 1:117838734-117838756 CCATTGCAATTGAGTGCAAGAGG + Intergenic
917506820 1:175634933-175634955 CCTTTGCCATTAAGAGAATGAGG - Intronic
922773938 1:228206575-228206597 CCATTGCCCGGAAGAGCCTGAGG + Intronic
1065219244 10:23479341-23479363 CCAATGGTTTTAAGAGCATGTGG - Intergenic
1072871473 10:99124948-99124970 CCACTGCCATCAATAGCATAAGG + Intronic
1073431809 10:103492096-103492118 GTGTTGCCATTAAGAGCCTGTGG + Intergenic
1073668771 10:105563457-105563479 CCATTGCCATTTAGGACAAGGGG - Intergenic
1073767892 10:106703512-106703534 CCATTGCCATTAAGAGCATGTGG - Intronic
1076966359 11:90169-90191 CGATTGCCATTAAGAACAGGTGG + Intergenic
1086389891 11:86352659-86352681 CCTTTTCCATTTAGAGCCTGTGG + Intergenic
1086633674 11:89055273-89055295 CAATTGCCAATAAAGGCATGAGG - Intronic
1087772336 11:102224183-102224205 CTATAGCCCTTAAGAACATGAGG - Intronic
1088885468 11:114002969-114002991 CCATTGCCACTCAGAGGAAGGGG - Intergenic
1091098529 11:132847008-132847030 CCAATGCCTGTAAAAGCATGAGG + Intronic
1093690814 12:22106519-22106541 CTATTGCCATTAAGAACATTTGG - Intronic
1095323058 12:40853233-40853255 CCATTGACCCTAAGAGCAAGAGG + Intronic
1096121341 12:49091339-49091361 CCATTGCCGTGATGAACATGTGG - Exonic
1098851295 12:75599631-75599653 GCATTGCCATTAATAGCAATAGG + Intergenic
1100407778 12:94285959-94285981 CCACTGCCATTAATAGGAGGAGG + Intronic
1101163541 12:102005002-102005024 TGATTGCCATTATGGGCATGTGG - Intronic
1101881009 12:108625767-108625789 CCAGTGCCAAGGAGAGCATGAGG - Intronic
1106522978 13:30514213-30514235 CCATTGCTATTATTATCATGAGG - Intronic
1108444318 13:50492005-50492027 CCATTTGCATTTAGAGCATCTGG - Intronic
1111374387 13:87358485-87358507 CCACTGGCATAAAAAGCATGTGG + Intergenic
1111781932 13:92739340-92739362 CTAAAGCCATGAAGAGCATGAGG + Intronic
1116195914 14:41724358-41724380 CCATTTACATTTAGAGCATAAGG + Intronic
1120146157 14:80981383-80981405 TCTTTGCCATTCAGATCATGGGG + Intronic
1126354654 15:47782585-47782607 ACATAGCCATTAAGAACTTGAGG - Intergenic
1130728090 15:86461883-86461905 CGATTGCCACCATGAGCATGTGG - Intronic
1130731432 15:86497456-86497478 CCATTGCTTTGAAGAGAATGTGG + Intronic
1132441769 15:101873356-101873378 CAATTGCCATTAAGAACAGGTGG - Intergenic
1134049971 16:11130648-11130670 CCATTGCCATCAAGGGCCCGTGG + Intronic
1135068419 16:19331318-19331340 CAATAGGCATTAGGAGCATGGGG + Intergenic
1136621692 16:31433719-31433741 CCAGTGGCATTAAGAACATAGGG - Intronic
1141641323 16:85343274-85343296 CCATTTCCATTACGTGCTTGAGG + Intergenic
1144770494 17:17756944-17756966 CCATTGCCTTTCAGAGTTTGTGG + Intronic
1151103930 17:71589797-71589819 CTATTGCCATGAAGAGAAGGTGG + Intergenic
1153652396 18:7252635-7252657 CCATAGCTTTTTAGAGCATGAGG - Intergenic
1155709269 18:28855787-28855809 CCATTGTCATTCAGAACATTTGG + Intergenic
1155946818 18:31862491-31862513 CCAGTACCATTAATAGAATGTGG - Intronic
1156252554 18:35365028-35365050 CCCTTGCCATTGAGTGCATTGGG - Intergenic
1158120615 18:54044135-54044157 CCATTCCCAGTGAGACCATGTGG + Intergenic
1160070868 18:75626639-75626661 CCATGGCCATAAAGAGCTTCAGG - Intergenic
1160419414 18:78733944-78733966 CCATTGCCATTCAGAACACAGGG - Intergenic
1160643162 19:159791-159813 CGATTGCCATTAAGAACAGGTGG + Intergenic
1162395739 19:10417301-10417323 GCATTGACATTAAGACCAAGAGG + Intronic
1164407906 19:27971044-27971066 CCATTGCTATTAAAAGCAGCGGG + Intergenic
1164624516 19:29717216-29717238 CAGTTGCCTTTAGGAGCATGAGG - Intergenic
925320432 2:2962301-2962323 CCATTTCCATTAAGACCACTGGG + Intergenic
927151943 2:20201216-20201238 CCTTTGCCATTTAGAAGATGGGG + Exonic
927852570 2:26509551-26509573 CCACTGGCATTAAGATCCTGGGG - Intronic
930215307 2:48690166-48690188 TCATAGCCAGTAAGAGCCTGGGG - Intronic
931605348 2:64047078-64047100 CCATTACAGTGAAGAGCATGTGG - Intergenic
931743706 2:65273136-65273158 CCTTTGCCATTCACAGCAAGTGG + Intergenic
934920730 2:98343129-98343151 CAAATACCATTAAGAGCTTGAGG - Intronic
938626404 2:133113801-133113823 CCATTACCACTAAGGGCCTGGGG - Intronic
938953446 2:136278177-136278199 CCCTTGGCATGAAGAGCTTGAGG + Intergenic
939481396 2:142752443-142752465 TAAGTGCCAATAAGAGCATGTGG + Intergenic
940046827 2:149418631-149418653 CCATTGACTTTAATAGCTTGAGG + Intronic
941801771 2:169667438-169667460 CAGTTGCCATTAAGAACATTTGG - Intronic
943427109 2:187750442-187750464 TCACAGACATTAAGAGCATGGGG + Intergenic
944028950 2:195209052-195209074 CCATAGTAATTAAGAGAATGCGG - Intergenic
944931941 2:204528906-204528928 GCATTGCAGTTAAGAGCATGAGG - Intergenic
947687530 2:232102247-232102269 CCAATGCCATGAAAAGCAAGGGG + Intronic
948285738 2:236783732-236783754 CCATTGCCCTGAGCAGCATGGGG + Intergenic
1169300948 20:4441447-4441469 CCATCACCATTCTGAGCATGTGG - Intergenic
1171755787 20:29108111-29108133 TTATTGACAGTAAGAGCATGGGG - Intergenic
1174757206 20:53171374-53171396 TAATTGCAATTAAAAGCATGTGG - Intronic
1175214088 20:57381250-57381272 ACATTGCAATTAAGAACAGGGGG + Intergenic
1180412829 22:12631980-12632002 TTATTGACAGTAAGAGCATGGGG - Intergenic
1185124959 22:49004845-49004867 CCCTTGTCATCAAGTGCATGGGG - Intergenic
950193994 3:10996160-10996182 CCAGTGCCCTTCAGAGAATGGGG - Intronic
952690773 3:36202696-36202718 CCATTGCCTATAAGACTATGAGG - Intergenic
957166109 3:76675972-76675994 CCCTTGCCATTAAGTGGATACGG + Intronic
960446090 3:117750650-117750672 CCAGAGCCAATAAGAGCATTTGG - Intergenic
960901812 3:122561490-122561512 CCATTGGCATTAACCACATGAGG - Intronic
962103490 3:132366865-132366887 ACATTATCATTAAGAGAATGAGG - Intronic
962942400 3:140137538-140137560 TCTTTGCCATCAAGAGCTTGGGG - Intronic
963234838 3:142946588-142946610 CCCTTTCCATTCACAGCATGAGG - Intergenic
966249190 3:177843550-177843572 CCAGGGCCATTAAGAGGAGGTGG + Intergenic
967445095 3:189556351-189556373 CTATTGCAATTAAAAGCATGTGG + Intergenic
974686958 4:65242735-65242757 CCATTGCCATCAAAAACATGTGG + Intergenic
975246493 4:72126816-72126838 CCACTGAGATTAAGTGCATGGGG + Intronic
975328161 4:73083799-73083821 ACATTGCCAGTTAAAGCATGAGG - Intronic
976234949 4:82887478-82887500 GCACGGCAATTAAGAGCATGGGG + Intronic
976570561 4:86603869-86603891 TCATGGCCATTAAGATCATTTGG + Intronic
977612030 4:99045912-99045934 ACATAGCCATTAAAAGAATGAGG - Intronic
978729952 4:112013939-112013961 GCATGGACATGAAGAGCATGAGG - Intergenic
981916568 4:150040347-150040369 TCAGTGCCATTAGGAACATGGGG + Intergenic
982419017 4:155172047-155172069 CCAGTGGCACTCAGAGCATGAGG + Intergenic
984814104 4:183821485-183821507 CCATGACCCTTAAGAGAATGCGG + Intergenic
985305259 4:188532654-188532676 CCATTGCCCTAAGGAACATGCGG - Intergenic
986102808 5:4629531-4629553 CTAATGCCATTAAGATCAGGAGG - Intergenic
987083394 5:14446468-14446490 GCAGTGCCATTCAGTGCATGTGG + Intronic
989140083 5:38193316-38193338 GCATTGCCACTCAGAGGATGTGG + Intergenic
999149952 5:149420249-149420271 CCATTTCTATTATTAGCATGGGG - Intergenic
1002733709 5:181364679-181364701 CAATTGCCATTAAGAACAGGTGG - Intergenic
1002750832 6:109439-109461 CGATTGCCATTAAGAACAGGTGG + Intergenic
1002829909 6:810565-810587 CCCTTGACATAAAGAGGATGGGG - Intergenic
1004275837 6:14234423-14234445 AAATTGCTTTTAAGAGCATGTGG + Intergenic
1004475669 6:15968902-15968924 CCATAGCCATGAAGAGCCTAAGG + Intergenic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1006741786 6:36313893-36313915 TAATTGACATTAAGAGCATCTGG - Intergenic
1008345080 6:50416747-50416769 TTATTGCCATAAAGAGCAAGGGG + Intergenic
1013276462 6:108589636-108589658 TAGTTGCCATTAAGAGCAGGAGG + Intronic
1018719085 6:166558679-166558701 CCTTTTCCGTTAACAGCATGGGG - Intronic
1019237959 6:170637001-170637023 CGATTGCCATTAAGAACAGGTGG - Intergenic
1020039593 7:4992031-4992053 CCATTGGCATGAAGAGTAAGTGG - Intronic
1020781146 7:12518359-12518381 CCACTGCCATTACCAGCATCTGG - Intergenic
1025226804 7:57172450-57172472 CCATTGCCAGTAAGAGTCTTCGG - Intergenic
1026215782 7:68347568-68347590 CCACTTCCCTTAAAAGCATGAGG + Intergenic
1027611557 7:80367702-80367724 AAATTGTCATTAAAAGCATGAGG + Intergenic
1028028708 7:85880637-85880659 CCATTGTCTTTCAAAGCATGAGG + Intergenic
1032967173 7:137111776-137111798 CCATTGCCATAAACAGCCTGAGG + Intergenic
1035509812 8:169610-169632 CAATTGCCATTAAGAACAGGTGG + Intergenic
1035842354 8:2826428-2826450 CCATTGCAAGTCAGAACATGAGG + Intergenic
1036134030 8:6142432-6142454 CCATCTTCATTAAGAGAATGTGG - Intergenic
1050791557 9:9477315-9477337 CCATTGAGATTAACAGCATGAGG + Intronic
1051161658 9:14214939-14214961 CCATGCCCATTAAGAAAATGTGG + Intronic
1051355141 9:16234021-16234043 CCCTTGCCATGAACAGCCTGGGG + Intronic
1056046941 9:82728452-82728474 TCATTGCCATTCAAAGCCTGGGG - Intergenic
1062758165 9:138317297-138317319 CGATTGCCATTAAGAACAGGTGG - Intergenic
1186194513 X:7097755-7097777 CCCTTTCCATTAGGAGCATCTGG - Intronic
1187188199 X:17007943-17007965 GCATAGAAATTAAGAGCATGGGG - Intronic
1187799833 X:23048946-23048968 CCACAGCAATTAAGAGCTTGAGG + Intergenic
1188115245 X:26234320-26234342 CCATTGCCATTTCAAACATGTGG - Intergenic
1195857049 X:109342922-109342944 CCATTGCCAGTTAGAGTATGAGG + Intergenic
1197924967 X:131636635-131636657 CCTATGGCATTCAGAGCATGGGG + Intergenic
1198496341 X:137197283-137197305 CCAGTGGCATTCAGAGGATGTGG + Intergenic
1201533857 Y:15023596-15023618 CCACTGCCATGAAGAGCCTAAGG - Intergenic