ID: 1073768718

View in Genome Browser
Species Human (GRCh38)
Location 10:106711488-106711510
Sequence AGTGGCACTCTGCAGAATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073768718_1073768727 23 Left 1073768718 10:106711488-106711510 CCTGTATTCTGCAGAGTGCCACT No data
Right 1073768727 10:106711534-106711556 CCCTCTGACCAATGACTGATGGG No data
1073768718_1073768725 22 Left 1073768718 10:106711488-106711510 CCTGTATTCTGCAGAGTGCCACT No data
Right 1073768725 10:106711533-106711555 TCCCTCTGACCAATGACTGATGG No data
1073768718_1073768729 24 Left 1073768718 10:106711488-106711510 CCTGTATTCTGCAGAGTGCCACT No data
Right 1073768729 10:106711535-106711557 CCTCTGACCAATGACTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073768718 Original CRISPR AGTGGCACTCTGCAGAATAC AGG (reversed) Intronic