ID: 1073770244

View in Genome Browser
Species Human (GRCh38)
Location 10:106727905-106727927
Sequence TCTCCTCACTCGTTGCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 157}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073770244_1073770249 2 Left 1073770244 10:106727905-106727927 CCTGCAGGCAACGAGTGAGGAGA 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1073770249 10:106727930-106727952 GCAGACTAAGATTAGGCTGAGGG No data
1073770244_1073770248 1 Left 1073770244 10:106727905-106727927 CCTGCAGGCAACGAGTGAGGAGA 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1073770248 10:106727929-106727951 GGCAGACTAAGATTAGGCTGAGG No data
1073770244_1073770252 27 Left 1073770244 10:106727905-106727927 CCTGCAGGCAACGAGTGAGGAGA 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1073770252 10:106727955-106727977 TGGGCAGACACAAGTTATGCTGG No data
1073770244_1073770251 8 Left 1073770244 10:106727905-106727927 CCTGCAGGCAACGAGTGAGGAGA 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1073770251 10:106727936-106727958 TAAGATTAGGCTGAGGGAATGGG No data
1073770244_1073770250 7 Left 1073770244 10:106727905-106727927 CCTGCAGGCAACGAGTGAGGAGA 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1073770250 10:106727935-106727957 CTAAGATTAGGCTGAGGGAATGG No data
1073770244_1073770247 -5 Left 1073770244 10:106727905-106727927 CCTGCAGGCAACGAGTGAGGAGA 0: 1
1: 0
2: 1
3: 11
4: 157
Right 1073770247 10:106727923-106727945 GGAGAGGGCAGACTAAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073770244 Original CRISPR TCTCCTCACTCGTTGCCTGC AGG (reversed) Intronic
900083337 1:875194-875216 TTTCCTCACTGGTTGCCAGTTGG - Intergenic
900760022 1:4464089-4464111 TCTCCTCACTCCAGGGCTGCTGG - Intergenic
900875774 1:5341567-5341589 TCAGCTCACCCCTTGCCTGCTGG + Intergenic
902093756 1:13925552-13925574 TCTCCTCATTCATTGCCTACCGG - Intergenic
904353523 1:29924153-29924175 TCTCCTCCCTGGCTGCCTGCTGG + Intergenic
906700820 1:47856842-47856864 TCACCTCTCTCTCTGCCTGCGGG - Intronic
911151865 1:94603969-94603991 TCTCCTCACCCCATGCCTCCAGG - Intergenic
917930883 1:179821736-179821758 CCTCCTCCCTCGTGTCCTGCCGG + Intergenic
920267472 1:204734781-204734803 GCTCCTCATTCCTTGACTGCAGG + Intergenic
921272591 1:213486075-213486097 TCTCCTCTCTCCTTCCCAGCAGG + Intergenic
922076197 1:222247378-222247400 TCTCCTCCCATGTTGACTGCTGG - Intergenic
922346501 1:224700860-224700882 TGTCCTGACTCTGTGCCTGCTGG - Intronic
922349637 1:224724611-224724633 TCTCCACACTCTTTGGCTCCTGG + Intronic
922489795 1:226006976-226006998 TCTCCTCACTAATTTTCTGCAGG - Intergenic
922671082 1:227509152-227509174 TCTCCTCACTAGTTGCCAGCTGG - Intergenic
923686234 1:236155553-236155575 TCTCCTCGCGGGCTGCCTGCTGG + Intronic
924172228 1:241355477-241355499 CCTCCTCACGTGTTCCCTGCTGG - Intronic
1063849467 10:10168633-10168655 TCTCCTGACTGATTGCTTGCAGG + Intergenic
1065315271 10:24457792-24457814 TCTTCTTACCCGTTGCCTCCAGG - Intronic
1065390387 10:25175993-25176015 TCTCCTCGCGCGTGGCCTGGAGG - Exonic
1073770244 10:106727905-106727927 TCTCCTCACTCGTTGCCTGCAGG - Intronic
1076607963 10:131701613-131701635 TCTCCTCACTGGTGTCCTGATGG - Intergenic
1077326568 11:1966607-1966629 CCTCCTCCCCCGGTGCCTGCTGG + Intronic
1079017079 11:16878306-16878328 TCTCCTCACTGGATGCCTCCTGG + Intronic
1079145304 11:17846022-17846044 TATCCTTACTCCTTGCCTGGAGG + Intronic
1080655369 11:34253782-34253804 TCTCCTCCTTCATTACCTGCTGG + Intronic
1081915644 11:46728547-46728569 TCCCCTCCCTGGTGGCCTGCAGG + Intronic
1083847568 11:65344978-65345000 TCTCCCCACTCCTTTCCTGCTGG + Intronic
1083881561 11:65551459-65551481 TCTCCTCACTCACCGGCTGCGGG + Exonic
1086276306 11:85133737-85133759 CCTCCTCACTTGCTGTCTGCAGG + Intronic
1089646950 11:119886719-119886741 TGTCCTCACCCATTTCCTGCAGG + Intergenic
1090584441 11:128195285-128195307 TCTGCTCACTCCTTTACTGCGGG - Intergenic
1202809549 11_KI270721v1_random:21786-21808 CCTCCTCCCCCGGTGCCTGCTGG + Intergenic
1091602997 12:1929311-1929333 TCGCCTCCCCCGATGCCTGCAGG - Intergenic
1092141791 12:6189110-6189132 TCTCTTCACTCTGTGGCTGCTGG - Intergenic
1095359179 12:41315157-41315179 TCTTCTCACTTGTTTCCTGTAGG - Intronic
1097925110 12:65118659-65118681 TCTCCTCCCTAATTCCCTGCAGG + Intronic
1100584370 12:95965956-95965978 TCTCCTCTCTCTATGCCTGCAGG - Intronic
1105704624 13:22961379-22961401 TCACCTCACTCCTTTCATGCAGG - Intergenic
1105857579 13:24386431-24386453 TCACCTCACTCCTTTCATGCAGG - Intergenic
1106793427 13:33179960-33179982 GCTCCTCCCTCTGTGCCTGCAGG + Intronic
1113576078 13:111396213-111396235 CCTCCTCCCTCGGTGCATGCTGG - Intergenic
1113739021 13:112698178-112698200 TCTCGTGACTCCTGGCCTGCTGG + Intronic
1113833267 13:113313500-113313522 TCTCCACACTGGCTGCCTCCAGG - Intronic
1113833292 13:113313596-113313618 TCTCCACACTGGTTCCCTCCAGG - Intronic
1113833318 13:113313692-113313714 TCTCCACACTGGTTCCCTCCAGG - Intronic
1113833343 13:113313788-113313810 TCTCCACACTGGTTCCCTCCAGG - Intronic
1113833394 13:113313980-113314002 TCTCCACACTGGTTCCCTCCAGG - Intronic
1113833420 13:113314076-113314098 TCTCCACACTGGTTCCCTCCAGG - Intronic
1113833459 13:113314220-113314242 TCTCCGCACTGGTTCCCTCCAGG - Intronic
1113833527 13:113314460-113314482 TCTCCACACTGGTTCCCTCCAGG - Intronic
1113833552 13:113314556-113314578 TCTCCACACTGGTTCCCTCCAGG - Intronic
1113833577 13:113314652-113314674 TCTCCACACTGGTTCCCTCCAGG - Intronic
1113833602 13:113314748-113314770 TCTCCACACTGGTTCCCTCCAGG - Intronic
1113833626 13:113314844-113314866 TCTCCACACTGGCTGCCTCCAGG - Intronic
1113833651 13:113314940-113314962 TCTCCACACTGGTTCCCTCCAGG - Intronic
1113833676 13:113315035-113315057 TCTCCACACTGGTTCCCTCCAGG - Intronic
1113938154 13:114005922-114005944 TCTCCCCACTCCTGCCCTGCTGG + Intronic
1113938215 13:114006106-114006128 TCTCCCCACTCCTGCCCTGCTGG + Intronic
1113938249 13:114006216-114006238 TCTCCCCACTCCTGCCCTGCCGG + Intronic
1113938298 13:114006364-114006386 TCTCCCCACTCCTGCCCTGCCGG + Intronic
1113938310 13:114006402-114006424 TCTCCCCACTCCTGCCCTGCCGG + Intronic
1113938359 13:114006550-114006572 TCTCCCCACTCCTGCCCTGCTGG + Intronic
1113938370 13:114006588-114006610 TCTCCCCACTCCTGCCCTGCCGG + Intronic
1113938419 13:114006736-114006758 TCTCCCCACTCCTGCCCTGCTGG + Intronic
1113938453 13:114006846-114006868 TCTCCCCACTCCTGCCCTGCCGG + Intronic
1113938488 13:114006956-114006978 TCTCCCCACTCCTGCCCTGCCGG + Intronic
1113938511 13:114007030-114007052 TCTCCCCACTCCTGCCCTGCCGG + Intronic
1113938523 13:114007068-114007090 TCTCCCCACTCCTGCCCTGCCGG + Intronic
1113938546 13:114007142-114007164 TCTCCCCACTCCTGCCCTGCCGG + Intronic
1119236887 14:73027040-73027062 CCTCCTCCTTCGTTGCCTCCCGG + Exonic
1119601274 14:75978911-75978933 TCTCCTCACACCTCTCCTGCCGG + Intronic
1121182575 14:91940616-91940638 TCTCCTCTCTCCTTCCCTGCAGG - Exonic
1122268592 14:100558217-100558239 CCTCCTTACTCCTAGCCTGCCGG + Intronic
1122289675 14:100673558-100673580 TCCCATCTCTCGCTGCCTGCCGG - Intergenic
1124646821 15:31442813-31442835 TCTCCCCACCCTGTGCCTGCAGG + Intergenic
1125032569 15:35087207-35087229 TCTCCTGTGTCTTTGCCTGCAGG - Intergenic
1125174290 15:36803080-36803102 TCTCTTCACTGCTTGCCAGCAGG + Intronic
1128983410 15:72202298-72202320 TCTGCTCAATCCTTCCCTGCAGG + Intronic
1133209284 16:4254080-4254102 GCTCCTCTCTCGGTCCCTGCGGG - Intergenic
1137694824 16:50454555-50454577 TCTCCTCATGCCTTGGCTGCAGG - Intergenic
1140606815 16:76549078-76549100 CCTCCTCACTGGTTCCCTCCAGG - Intronic
1140694784 16:77521917-77521939 TCTCCTCAGTCATTGGCTGGGGG - Intergenic
1141498433 16:84426442-84426464 TCTTGTCACTCTTTGCCTGTGGG + Intronic
1141632672 16:85296977-85296999 TGACCTCACTCTGTGCCTGCTGG + Intergenic
1143994419 17:10994295-10994317 TTTCTCCACTCCTTGCCTGCAGG + Intergenic
1144028378 17:11298546-11298568 TGTCATCACCTGTTGCCTGCTGG - Intronic
1145994330 17:29096885-29096907 TCTCCTCACTATCTGCCTGCAGG + Exonic
1147378592 17:40038280-40038302 TCTACTAACTAGTTGCCTTCTGG + Intronic
1148254734 17:46119896-46119918 GCTCCTCACTCATTGCCTATGGG + Intronic
1148784882 17:50141134-50141156 TCTGCTGACTCCTTGGCTGCAGG - Intronic
1149328311 17:55555771-55555793 TCTCCCCACTCGGTCCCTTCAGG + Intergenic
1149646065 17:58242498-58242520 TCCCCTCCCTCCTTCCCTGCAGG - Intronic
1151714313 17:75823666-75823688 TCTCCTCACCCATTCCCAGCAGG - Intronic
1154041969 18:10865013-10865035 TCTCCTCACTCTTGTCCTTCTGG - Intronic
1155179970 18:23336196-23336218 TCCCCTCCCACGTTCCCTGCAGG + Intronic
1156771876 18:40737824-40737846 TCTCCTCTCCCTTTGCCAGCTGG - Intergenic
1157442049 18:47718953-47718975 TCTCCTCCCTCACGGCCTGCAGG + Intergenic
1157831519 18:50860941-50860963 TTTCTTCACCAGTTGCCTGCTGG + Intergenic
1159846991 18:73473070-73473092 TCTCCTCACTTCTAGCTTGCTGG - Intergenic
1161167917 19:2798415-2798437 TCTGCTCCCTCCTTGCTTGCTGG - Intronic
1164712998 19:30372326-30372348 GCTGCTCACACGTGGCCTGCTGG + Intronic
927682126 2:25146646-25146668 CCTCCTCACTAGTGGCCTCCTGG + Intronic
928288712 2:30018142-30018164 TCTCCTGGCTCTCTGCCTGCAGG - Intergenic
932219841 2:69991004-69991026 CCTCCTCAAACGTGGCCTGCTGG + Intergenic
932426989 2:71644165-71644187 TCTCCTCATTCGGTGTCTGAGGG + Intronic
932570798 2:72937385-72937407 CCTCCTCTCCCCTTGCCTGCAGG - Intergenic
934147194 2:89106829-89106851 TCACTTCCCTGGTTGCCTGCAGG + Intergenic
934222077 2:90093765-90093787 TCACTTCCCTGGTTGCCTGCAGG - Intergenic
936844085 2:116809131-116809153 TCTCCTCATTAGTTTCCTACAGG + Intergenic
937780902 2:125836026-125836048 TGTCCTCAATGGTTGGCTGCAGG - Intergenic
939211074 2:139175447-139175469 TCTCCTCTCTGGTTTCCAGCAGG + Intergenic
940342285 2:152593997-152594019 TCTCTTCACTCTTTTCCTTCTGG - Intronic
945024539 2:205607331-205607353 TCTGCTCACATGGTGCCTGCTGG - Intronic
947238729 2:227971315-227971337 TCTCTTTTCTCGTTGCCTCCTGG + Intergenic
947393337 2:229662605-229662627 TCTCCTCCCTCATGGCCTTCAGG + Intronic
1169037006 20:2462016-2462038 TCTCCTCACTCGATTACTGCAGG - Intronic
1169501187 20:6162456-6162478 TTTCCTCACTCCATGCCTGTGGG + Intergenic
1170992205 20:21313320-21313342 TGTCCTCATTTGTTGCCAGCTGG + Intronic
1174188851 20:48725616-48725638 TGTCCTCACTCATGGCCTGTGGG + Intronic
1175516452 20:59573546-59573568 AGTCCTCACTCCATGCCTGCAGG + Intergenic
1180080655 21:45486245-45486267 TCTCTTCTCCCCTTGCCTGCCGG + Intronic
1180592851 22:16955695-16955717 TCTCCTCACCCATGGCCTCCAGG - Intergenic
1181167158 22:20989875-20989897 TCTCCTCCCTGGTGACCTGCGGG + Intronic
1182361176 22:29747442-29747464 TCTCCTCCCTTCTTGGCTGCTGG + Intronic
1183325275 22:37188085-37188107 TCTCCTCCCTCCTTGCTTCCTGG - Intronic
1185425585 22:50768489-50768511 TCTCTTCACTGTCTGCCTGCGGG + Exonic
954305005 3:49721013-49721035 CCTCCTCACTGGTGGGCTGCAGG - Exonic
955513220 3:59701525-59701547 TCCCCTCACTCTTTCCCTGATGG - Intergenic
956992400 3:74782236-74782258 TCAACTCCCTCATTGCCTGCTGG + Intergenic
960884425 3:122380212-122380234 TCTCCTCTCCCTTTGCCTGATGG + Intronic
960899518 3:122540829-122540851 TCTCCTCTCTGGTTGACTGGGGG + Exonic
963150786 3:142043664-142043686 TCTCCTCCTTCTTGGCCTGCAGG + Intronic
967920150 3:194608428-194608450 TCTCCTGTCTCGTTGACTCCTGG - Intronic
968258088 3:197297676-197297698 TCTCCTTGCTCGCTGCCTCCGGG + Intronic
979707256 4:123735341-123735363 TATGCTCACTCTTTGCCTACAGG - Intergenic
995437834 5:112157910-112157932 TCTGCTTCCTCCTTGCCTGCTGG - Intronic
995767900 5:115638819-115638841 TCTCCACCCACCTTGCCTGCTGG + Intergenic
1000633260 5:163615200-163615222 TCTCCTCCCTAGTTTCCTGGTGG + Intergenic
1001282152 5:170394130-170394152 TCTCCTCTGTCCTTGCCTCCTGG + Intronic
1003966738 6:11259088-11259110 TCTCCTCACCCAATGGCTGCAGG + Intronic
1013069212 6:106713571-106713593 TCTCCTCTCTCTCTGGCTGCTGG + Intergenic
1018583038 6:165324265-165324287 CCTCTTCACTCCTTGCCTGGAGG - Intergenic
1023834753 7:44061561-44061583 GCGGCTCACTCGATGCCTGCAGG + Exonic
1024581161 7:50802208-50802230 TCTCCTAACTCACTTCCTGCTGG - Intergenic
1027110406 7:75434030-75434052 TCTCCTCACACGTTGCTAGTGGG - Intronic
1028268516 7:88759049-88759071 TTTACTCTTTCGTTGCCTGCTGG - Intergenic
1028392943 7:90336418-90336440 TCTCCTATCTCCTTGACTGCAGG - Intronic
1033162550 7:139010427-139010449 TCTCCTCACTCGTTGAATCTGGG - Intergenic
1033269372 7:139916841-139916863 TCTCCTCAATGGATGCCAGCAGG - Intronic
1033798962 7:144878740-144878762 TCACCTCAATCTTTGCCTCCTGG + Intergenic
1034205063 7:149307957-149307979 CCTCCTCACTTGCTTCCTGCAGG + Intergenic
1039976419 8:42370115-42370137 AATCCTCTCTCGTTGCCTGAAGG - Intronic
1043783008 8:84360758-84360780 TCCCCACACTCAATGCCTGCAGG - Intronic
1048167461 8:132076323-132076345 TCTCCTGACTCTTTTCCTGCAGG + Intronic
1049152535 8:141044542-141044564 TCCCCGCACCTGTTGCCTGCTGG - Intergenic
1049906619 9:223399-223421 TCTCCTCACTCCTTGCAGGCAGG - Intronic
1049991519 9:996123-996145 TGTCCTCACTAGCAGCCTGCTGG + Intergenic
1051591462 9:18780039-18780061 TCTGCTCAGCCTTTGCCTGCAGG + Intronic
1059491479 9:114671314-114671336 TTTGCTCACTCTCTGCCTGCTGG - Intergenic
1060821889 9:126665926-126665948 TCTCCGCACATGCTGCCTGCTGG - Intronic
1061012152 9:127962056-127962078 TCTCTTCTGGCGTTGCCTGCTGG - Intronic
1061049439 9:128185776-128185798 TCTCCTGTCTTCTTGCCTGCAGG - Exonic
1061950278 9:133932201-133932223 TCTCCACACTCCTTCCCAGCTGG + Intronic
1185801493 X:3015325-3015347 TCTCCTCTTTCATTGGCTGCTGG - Exonic
1187238211 X:17488025-17488047 TCTCCTCACCTGTATCCTGCCGG + Intronic
1189330928 X:40144774-40144796 TCTGTTAACTCCTTGCCTGCTGG + Intronic
1190498336 X:51049468-51049490 TCCACTCACTCTTAGCCTGCAGG - Intergenic
1194766478 X:97848449-97848471 CCTCCTCACTTGTTGCCTCCGGG + Intergenic
1195570835 X:106397000-106397022 CCTCTCCACTCGGTGCCTGCAGG - Intergenic