ID: 1073779888

View in Genome Browser
Species Human (GRCh38)
Location 10:106825612-106825634
Sequence GCTGGGATGCAGAAGGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 2, 2: 3, 3: 21, 4: 318}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073779888_1073779891 -10 Left 1073779888 10:106825612-106825634 CCCATCACCTTCTGCATCCCAGC 0: 1
1: 2
2: 3
3: 21
4: 318
Right 1073779891 10:106825625-106825647 GCATCCCAGCTGTTCCTTTCCGG No data
1073779888_1073779894 -4 Left 1073779888 10:106825612-106825634 CCCATCACCTTCTGCATCCCAGC 0: 1
1: 2
2: 3
3: 21
4: 318
Right 1073779894 10:106825631-106825653 CAGCTGTTCCTTTCCGGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073779888 Original CRISPR GCTGGGATGCAGAAGGTGAT GGG (reversed) Intronic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
903875736 1:26472171-26472193 GCTGGGTTGCATAAGGTGGAAGG + Intergenic
905299343 1:36975866-36975888 GCTGGGATACAGAAAGGAATGGG - Intronic
905885193 1:41487996-41488018 GCTGGGCTGCAGCAGGTGCCTGG + Intergenic
906061381 1:42951203-42951225 AGTGGTATGAAGAAGGTGATGGG + Intronic
906156506 1:43617174-43617196 GCTGGGATGGGGCAGGTGAAGGG - Intronic
906677510 1:47703660-47703682 CCTGGGATGCAGAAGGGCCTGGG - Intergenic
908796418 1:67834183-67834205 ACTGCGATGCTAAAGGTGATGGG + Intergenic
909588372 1:77317304-77317326 GCTAGGTTACAAAAGGTGATAGG - Intronic
911652463 1:100405173-100405195 GCTGGGAGGCAGAGAGTGAGGGG - Intronic
913255679 1:116951084-116951106 GTTGGGATTCAGAAGCTGAAGGG - Intronic
913314593 1:117539381-117539403 GCTGGGAAGCAGGAAGTGGTGGG - Intergenic
913319689 1:117579477-117579499 GCTGGGAGGCACAGGGTGAGTGG - Intergenic
915291619 1:154888027-154888049 GCTGGCATGCAGAAGCAGCTGGG - Intergenic
917727622 1:177842469-177842491 GCTGGGAAGCAGCAGAAGATGGG - Intergenic
918973933 1:191456168-191456190 GCTGAGACGTAGAAGGGGATAGG + Intergenic
920340038 1:205269896-205269918 GCTGGGCTGCAGGAGGGGGTGGG - Intronic
920378629 1:205522940-205522962 ACTGGGAGGAAGAAGGTGACTGG + Intronic
922120709 1:222664924-222664946 GCTGGGATTCATAAAGTGCTGGG - Intronic
922415799 1:225422136-225422158 GGTGGGAAGCAGAAGCAGATCGG + Exonic
923640287 1:235751243-235751265 GATGGGGAGCAGAAGGTGACTGG + Exonic
923739930 1:236645910-236645932 CCTGGGGTGCAGCAGGTGACTGG + Intergenic
924658572 1:245995646-245995668 TCTGGGATGCAGTAGGGGGTGGG + Intronic
1063352013 10:5364847-5364869 GCTAGGATGCAAAAGGAGTTGGG + Intergenic
1063364850 10:5483755-5483777 GGTGGGATGCACATGGTGCTAGG + Intergenic
1065674490 10:28159539-28159561 GATAGGATGCAGGAGCTGATAGG - Intronic
1065798343 10:29328030-29328052 GCTGGCATGGAGCAGGTCATTGG - Intergenic
1067474578 10:46557099-46557121 GCTAGGATGGAGAAGGCGAGAGG - Intergenic
1067691483 10:48504780-48504802 GCTGGGATGCAGGTGGTGACAGG + Intronic
1067852140 10:49761052-49761074 GCTGGGATGCAGGTGGGGGTGGG - Intronic
1070734122 10:78851940-78851962 GATGGAATGCAGAAGGGGAGGGG - Intergenic
1070805586 10:79268900-79268922 GCAGGGCTGCAGAAGGTGATTGG + Intronic
1071961314 10:90810921-90810943 CCTAGGATGTAGAAGGTGTTGGG - Intronic
1072285123 10:93906938-93906960 GCTTGAATGCAGAAGCAGATAGG + Intronic
1072820646 10:98553663-98553685 TCTAGGATCCAGAAGGTGAGAGG - Intronic
1073214276 10:101828085-101828107 GGTGGCGTGCAGAGGGTGATGGG - Intronic
1073779888 10:106825612-106825634 GCTGGGATGCAGAAGGTGATGGG - Intronic
1074361196 10:112825251-112825273 GCAGGGAGGTAGAAGGTGAGTGG - Intergenic
1074532397 10:114306181-114306203 GCGGGGCTGCAGGAGGGGATGGG + Intronic
1074724990 10:116299332-116299354 GTTGGGAGGAAGAAGGGGATAGG - Intergenic
1076101069 10:127778952-127778974 GCTGGGAGGCAGAGGTTGAAGGG - Intergenic
1077062364 11:623503-623525 GCTGGGATGCAACAGGGCATAGG + Intronic
1077840789 11:5972588-5972610 GCTGGCTTGGAGAAGGGGATGGG - Intergenic
1077895519 11:6450654-6450676 GCTGGGATGCTGAGTGGGATGGG + Intronic
1078357976 11:10647038-10647060 GCTGGCAGGCAGAAGGGGTTTGG + Intronic
1078511236 11:11985817-11985839 GCTGGGATTTGGAAGGTGAGAGG - Intronic
1079314708 11:19397869-19397891 GCTGGGCTGCAGTAGGGGAGGGG + Intronic
1079621923 11:22566374-22566396 GCTGGGAGGCAGCAGGGGAAGGG + Intergenic
1080644720 11:34180195-34180217 GCTGGGATGGAGTGGGTGGTGGG - Intronic
1080735313 11:35008398-35008420 TCTGGTCTGCAGAAGGTGAAAGG - Intronic
1081235778 11:40645740-40645762 GCTGGGATGCAGAATTTTGTGGG - Intronic
1081255898 11:40894576-40894598 GCTGGGATGCAGAAAGTGACTGG - Intronic
1082738265 11:56881556-56881578 GTTGGGAAGCAGGAAGTGATGGG + Intergenic
1083261564 11:61525880-61525902 GATGGGATGCAGAAGGGAAGAGG + Intronic
1084665914 11:70576190-70576212 GCTGGGATGCAGACGAGGAAAGG + Intronic
1085774306 11:79351769-79351791 TTTGGGATGGAGAAGATGATTGG - Intronic
1089248165 11:117137578-117137600 GCTGGGGTTCAGAGGGCGATGGG - Intergenic
1089258547 11:117206983-117207005 GCTGGGGTTCAGAGGGCGATGGG + Intronic
1089363844 11:117909153-117909175 ACAGGGCTGCAGAAGGTGCTGGG + Intronic
1089459801 11:118645842-118645864 TCGGGGAGGCAGAAGGTGTTGGG + Intronic
1089628121 11:119764652-119764674 GCAGGGCTGCTGAAGTTGATGGG + Intergenic
1089772755 11:120815264-120815286 GCGGGTGTGCAGAAGGTGAGGGG + Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090387923 11:126367246-126367268 GGTGGCATGCAGAAGGGGAGGGG - Intronic
1090390562 11:126384692-126384714 GGTGGCATGCAGAAGGGGAGGGG - Intronic
1090482490 11:127080656-127080678 GCTGGGATGATGAAGGTCGTGGG - Intergenic
1091617285 12:2059219-2059241 GCTGAGATGCAGAAGGTGAGGGG + Intronic
1091848769 12:3678506-3678528 GCTGGGGAGCTGATGGTGATAGG + Intronic
1092565104 12:9656839-9656861 GAGGGGTTGCAGAAGATGATGGG + Intergenic
1094058086 12:26286463-26286485 GCTGGGAGGCAGCAGGAGAAAGG + Intronic
1095122044 12:38430884-38430906 GCTGGGAGGCAGAAGGTGATGGG + Intergenic
1095579370 12:43779289-43779311 ACTGAGATGCAGAAAGTTATAGG + Intronic
1096716055 12:53492366-53492388 CCTGGCACGCAGAAGGTGCTCGG + Intronic
1097350846 12:58547058-58547080 GCTGGGATAGAGAGGGTGACTGG + Intronic
1097732612 12:63146661-63146683 ACTGAGATGCTGAAGGTGAGAGG - Exonic
1100399519 12:94216835-94216857 GGTGGGATGCAGAGGGAGCTGGG - Intronic
1101259447 12:103013550-103013572 GCAGGGGTGCAGCAGGTGGTGGG + Intergenic
1104112647 12:125718116-125718138 CCTGGGATTCAGATTGTGATGGG + Intergenic
1104252956 12:127113311-127113333 GCTGGGAGGCAGAAGGAGGCTGG + Intergenic
1107725268 13:43292861-43292883 GCTGTGATGAAGATGGTGACTGG - Intronic
1108202895 13:48059891-48059913 CCTAGGATGTAGAAGGTGTTGGG - Intronic
1108593907 13:51934477-51934499 GCTGGACTGTAGAAGGTGAGAGG - Exonic
1110275608 13:73639069-73639091 GATGGGATGCAGGAGGAGAGGGG + Intergenic
1112237027 13:97645811-97645833 CCTAGGATGTAGAAGGTGTTGGG - Intergenic
1113308952 13:109110913-109110935 GCTGGTATGAAGAAGGTGCTTGG + Intronic
1113881475 13:113629088-113629110 GCTGGTGAGCAGCAGGTGATGGG + Intronic
1115691102 14:35844447-35844469 CCTGGGAAGCATAAGGTGTTGGG - Intronic
1115801487 14:36999130-36999152 ACTGGGAAGCAGTAGGTGAATGG + Intronic
1121230055 14:92350852-92350874 GTTAGGAGGCAGGAGGTGATTGG + Intronic
1122719310 14:103713311-103713333 TCTGGGATGCGGCAGGTGCTTGG - Intronic
1122956482 14:105073839-105073861 GGTGGGCTGCAGAACCTGATGGG - Intergenic
1126163198 15:45632644-45632666 GCTTGGATGTGGAGGGTGATGGG + Intronic
1127055225 15:55124724-55124746 GCTGGGATGCAGAAGATGCAGGG + Intergenic
1128756164 15:70185392-70185414 GCTGGGAGGCAGAACTTGATGGG + Intergenic
1131338265 15:91571290-91571312 GGTGGGATGCAGAAGAAGATGGG + Intergenic
1131398497 15:92105754-92105776 GCTGGGATGCAGAAGGGAGATGG + Intronic
1131604317 15:93884932-93884954 GCTGAGGTCCAGAAGGTGAATGG - Intergenic
1132237814 15:100235128-100235150 GATAGGATGCAGGAGGTGCTCGG + Intronic
1132312018 15:100864107-100864129 GCTGGGATGCAGTGGGAGAGGGG + Intergenic
1132367750 15:101269801-101269823 GATGGGATCCAGGCGGTGATGGG + Intergenic
1133512295 16:6471823-6471845 GCAGGGATGCAGAGTGTGGTTGG + Intronic
1134074002 16:11277805-11277827 GCTGGGATGGACAAGGAAATGGG + Intronic
1135203396 16:20460277-20460299 GCTGACATGGAGAAGGTAATGGG + Exonic
1135215607 16:20564661-20564683 GCTGACATGGAGAAGGTAATGGG - Exonic
1135697296 16:24601027-24601049 GCTTGAATGTAGACGGTGATAGG - Intergenic
1136550683 16:30980855-30980877 GCTGGGCTGCAGGAGGGGCTGGG + Intronic
1138395046 16:56697606-56697628 GCTGGGATGCAGACCTTGATGGG + Intronic
1141203479 16:81914770-81914792 GCTGGGATGTAGTTGGTGGTTGG + Intronic
1141858592 16:86701372-86701394 GCGGGCATGCAGCAGGTGCTCGG + Intergenic
1142169738 16:88615309-88615331 GCTGGCAAGCAGGAGGGGATGGG - Intronic
1142521488 17:507883-507905 ACTGGGATGGAGAAGGGGCTTGG - Intergenic
1142876116 17:2853122-2853144 GCTGGGATGCAGAGTGGGCTGGG - Intronic
1143039735 17:4025000-4025022 GCTGCTTTGCAGAAGGTGACTGG + Exonic
1143101292 17:4506173-4506195 GCTGACGTGCAGAAGGTGAGCGG - Intronic
1143430780 17:6881589-6881611 GCTGGGAAGCATAATGTGGTGGG - Intronic
1145837282 17:27964062-27964084 CCTGGGATGTGGAAGGTGTTTGG - Intergenic
1146182231 17:30705828-30705850 GCTGGGATGCTGGAGGTGCTAGG + Intergenic
1146484054 17:33229183-33229205 GCTGAGATGGAGGAGGGGATAGG + Intronic
1148331240 17:46815116-46815138 GCTGGAATGTAGCAGGTGCTGGG + Intronic
1148824572 17:50382958-50382980 GCTGGGAGGCAGCAGGTGCTGGG + Exonic
1149453288 17:56766816-56766838 GGTGGGAGGTAGAAGGTGAGAGG + Intergenic
1149454462 17:56776783-56776805 GCTGGAATGGAGAAGGTGAATGG - Intergenic
1149607733 17:57936562-57936584 GCTGGGATGCAGATGGGCAGCGG + Intronic
1150635616 17:66911250-66911272 GCTGAGATGGAGAAGGTGTTGGG - Intergenic
1150653125 17:67022751-67022773 GCTGGGAGACAGCAGGTGCTTGG + Intronic
1151560115 17:74865516-74865538 GCTGGAGTGCAGAAAGTGAAGGG + Intronic
1151708529 17:75785580-75785602 TCTGGGAGCCCGAAGGTGATGGG + Intronic
1151747092 17:76017623-76017645 GCTGGGATGGAGATGGAGAAGGG - Intronic
1151935289 17:77257448-77257470 GATGGGATGGAGGAGGTGACAGG - Intergenic
1154395892 18:13988355-13988377 GTTTTGATGGAGAAGGTGATGGG + Intergenic
1156337407 18:36183774-36183796 CCTGGGATGAGGAAGGAGATAGG - Intergenic
1156339747 18:36200475-36200497 TCTGGGAGGCAGAAGTTGACTGG + Intronic
1157574773 18:48736251-48736273 TCTGGGATGAGGAAGGTGAAGGG + Intronic
1157839619 18:50944522-50944544 GGAGGCATGCAGAAGGTGACTGG - Intronic
1158181055 18:54715254-54715276 GCTGGACTGCAGAAGGGGAGTGG - Intergenic
1160113747 18:76057956-76057978 GCTGGGGTGCAGGAGGAAATGGG - Intergenic
1161202963 19:3025961-3025983 GCTGGGAAGGAGAAGGGGGTGGG - Intronic
1161380353 19:3961547-3961569 GCTGGGAGGCAGACGCTGTTGGG - Intronic
1162976601 19:14209974-14209996 GCTGGGATGCTGGAGGTGCTAGG - Intergenic
1163272996 19:16265475-16265497 GCTGGTGTGCAGGAGGAGATGGG + Intergenic
1164623948 19:29714729-29714751 GGTGGGGTGCGGAATGTGATGGG - Intronic
1164699947 19:30278197-30278219 CCTGGGAGGCAGAAGGCGAGAGG + Intronic
1164719977 19:30424898-30424920 GGTGGGAAGCAGAAGGTGGCAGG - Intronic
1165397159 19:35570729-35570751 GGTGGGATGGAGAAGGGGTTGGG + Intergenic
1165891306 19:39113827-39113849 GCTGGGAGGCTGCAGGGGATGGG + Intergenic
1167687353 19:50964847-50964869 ACTGGGGGGCAGAAGGTGCTGGG - Intronic
1168121458 19:54254517-54254539 CCTGGGATGCAAATGGTGAAAGG - Intronic
925213906 2:2075882-2075904 GCCGGGATGAAGAGGGGGATGGG - Intronic
925711571 2:6746263-6746285 GATGGGTTACAGCAGGTGATGGG + Intergenic
927243082 2:20935681-20935703 TCTGGGTTGCAAAAGGTGAAGGG - Intergenic
927949721 2:27159318-27159340 GCTGGGATGTAGGAGGTGGGTGG - Intergenic
927954877 2:27201204-27201226 GCTGGGATGTAGGAGGTGGGTGG - Intronic
928023698 2:27723000-27723022 CCTGGGATGCAGAGGTTGAAGGG - Intergenic
928200037 2:29241948-29241970 GCTGGGATGCACAAAGAGAGGGG + Intronic
929779429 2:44948369-44948391 GCTGGAGGGCAGAAGGGGATTGG + Intergenic
930052131 2:47224622-47224644 GCTGGGATGCTACAGGAGATGGG - Intergenic
930561569 2:52965819-52965841 GCTGGGAAGCGCAAGGTGAAGGG + Intergenic
932296045 2:70624128-70624150 CCTAGGATGTAGAAGGTGTTGGG - Intronic
934479192 2:94619138-94619160 GCTGGGACTGACAAGGTGATTGG - Intergenic
934718727 2:96558317-96558339 GCAGGGATGCAGGAAGTCATGGG - Intergenic
935317536 2:101850698-101850720 GTTGGTATGCAGAAGGTGGCTGG + Intronic
937411461 2:121680380-121680402 GCTGAGATGAAGAAGGATATGGG + Intergenic
937463781 2:122111682-122111704 GGGGGGATGCAGCAGGTGACAGG - Intergenic
938108277 2:128547860-128547882 CCTGGGAAGCAGAAGGGGAAAGG + Intergenic
939640848 2:144638521-144638543 TCTGGGATGCTCAAGGTGGTGGG - Intergenic
942590200 2:177536033-177536055 GCTGGAAAACAGAAGGTGCTTGG - Intronic
946396123 2:219444573-219444595 GCAGGGAGGCAGAAGGCAATAGG + Intronic
948293906 2:236847077-236847099 GCTGGGAGGCAGACTGTGTTGGG + Intergenic
948299374 2:236890524-236890546 GATGAGGTGCAGAAGGGGATGGG + Intergenic
948491804 2:238318234-238318256 GCTGGGGTGGGGAAGGAGATGGG + Intergenic
948838627 2:240638105-240638127 GCTGGGAGCCAGGAGGGGATAGG - Intergenic
1170664855 20:18378044-18378066 GAGGGGATGAAGAAGGAGATGGG + Intergenic
1173037925 20:39430410-39430432 GCAGGGGTGCAGTAGGTTATAGG - Intergenic
1173435400 20:43027934-43027956 GCTGGGATGGAAATGCTGATGGG - Intronic
1173556907 20:43972860-43972882 GCTGGGATGGCATAGGTGATGGG + Intronic
1173650332 20:44659703-44659725 GCTGGAAGGCAGATGGTGAGTGG - Intergenic
1175464597 20:59181983-59182005 GCTGGCATGCAGAATAAGATTGG - Intergenic
1175553671 20:59832814-59832836 GTTGGGATCCAGAGGATGATTGG - Intronic
1178350175 21:31867208-31867230 GGTGGGATGCAGATTGTGCTGGG + Intergenic
1179416456 21:41202467-41202489 GCTGGAAAGCAGTAGGGGATGGG + Intronic
1180850989 22:19020102-19020124 GTTGGAATGCAGAAGGAGACAGG + Intergenic
1181018917 22:20088066-20088088 GCTGGGGTGCACAAGGTGGCAGG + Intronic
1182188268 22:28430811-28430833 GCTGAAATCCAGACGGTGATTGG - Intronic
1183173458 22:36204823-36204845 GCTGGACTGCAGGAGGTGCTGGG - Exonic
1184087225 22:42272115-42272137 CCTGGCATGCAGGAGGTGTTGGG - Intronic
1184379785 22:44138108-44138130 GCTGGCATGCAGCAGGTCCTTGG - Intronic
1184401313 22:44276247-44276269 GCTGGGATCCAGGAGGAGAGAGG + Intronic
950303627 3:11901821-11901843 GGGTGGGTGCAGAAGGTGATGGG + Intergenic
950713534 3:14831189-14831211 GGTGGAGTGCAGAAGGCGATGGG + Intronic
950845914 3:16015862-16015884 GCTAGGGTGGAGCAGGTGATCGG + Intergenic
951277046 3:20700354-20700376 GCTGTGTTGGAGAAGGTTATAGG + Intergenic
952763416 3:36935086-36935108 GCTGGGAGGCAGATGGGGTTGGG - Intronic
953056039 3:39387896-39387918 CCTGGGGTGCAGCAGGTGCTTGG + Intronic
953360248 3:42289439-42289461 GCTTGGAAGCATAAGGGGATGGG + Intergenic
954083259 3:48224688-48224710 TCTGGGATGCAGGGGCTGATGGG + Intronic
954315525 3:49799284-49799306 GGTGGGTTGAAGAAGGTGGTGGG + Exonic
956079946 3:65548042-65548064 GCAGGGTTGCAGGAGGTTATTGG - Intronic
956321423 3:68000845-68000867 GATTGGATGCAGAAGTTTATGGG + Intergenic
956863416 3:73346825-73346847 GCTGGGGTACAGAGGGTTATGGG + Intergenic
959278148 3:104304192-104304214 CCTGGGAGGCAGAAGGGGTTGGG + Intergenic
960317115 3:116191554-116191576 GCTGGGATCCAAAAGTTGACTGG - Intronic
960684294 3:120281484-120281506 GCTGGGATGGGGAAGCTGAGAGG + Intronic
960845111 3:121997661-121997683 GCTGTGAGGCAGAAGGAGATGGG + Intronic
961633682 3:128319590-128319612 CCTAGGAGGCAGAAGGCGATGGG - Intronic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
962262279 3:133919494-133919516 GCAGACATGCAGAAGGTGATTGG + Intergenic
962841359 3:139235581-139235603 TTTGGGAGGCAGATGGTGATGGG - Intronic
963377707 3:144491408-144491430 GATGAGATGCAGCAGTTGATGGG + Intergenic
966067028 3:175831191-175831213 CCTAGGATGTAGAAGGTGTTGGG - Intergenic
967341681 3:188405597-188405619 GCTGAGATGCAGAAAAAGATAGG - Intronic
968757816 4:2425978-2426000 GCTGGGGAGCAGAAGGTCCTGGG - Intronic
968953951 4:3708765-3708787 GATGGGATGCAGGTGGTGAGGGG - Intergenic
969147720 4:5138861-5138883 TCTGGCATTCAGTAGGTGATGGG + Intronic
969648440 4:8447926-8447948 GCGGGGTTGCAGGAGGTGCTTGG + Intronic
969664646 4:8550053-8550075 GGTGGAAGGCAGAAGGTGAAAGG - Intergenic
969840333 4:9877154-9877176 GCTGGGATACTTAAGGTAATTGG + Intronic
971549076 4:27926603-27926625 GCTGGAATCTAGCAGGTGATAGG - Intergenic
973067245 4:45811044-45811066 GCTGGGAAGAAGAAGGGGAAGGG - Intergenic
973216282 4:47673008-47673030 GCTGGGATGCTGAAAGTCTTCGG - Intronic
973585257 4:52384129-52384151 GCTGGGATCCACCAGGTGCTGGG - Intergenic
974355379 4:60806188-60806210 GCTGGGATGCAGACAATGACAGG + Intergenic
975247964 4:72142367-72142389 GCTGGGAAGCAAAAGGGGTTGGG - Intronic
975398362 4:73904437-73904459 ACTTGGATGGAAAAGGTGATGGG - Intergenic
976481835 4:85555669-85555691 GCTGGGAGGCAGCAGGAGAAGGG + Intronic
976563946 4:86532443-86532465 TATGGAATGCAGAAGGAGATAGG - Intronic
976775102 4:88698678-88698700 GCAGGGAAGCAGACGGTGTTGGG - Intronic
976983659 4:91265571-91265593 GCCATGATGCTGAAGGTGATAGG + Intronic
979259025 4:118632066-118632088 GCTGGGAGGCCGAAGGTGGCTGG - Intergenic
980032494 4:127846321-127846343 GCTGGGGTGGAGGAGGTGTTAGG - Intergenic
982341524 4:154304096-154304118 TCTAGGATGCAGATGGAGATGGG + Intronic
982414002 4:155110677-155110699 CCTAGGATGTAGAAGGTGTTGGG + Intergenic
985572159 5:652829-652851 AGTGGGACACAGAAGGTGATGGG + Intronic
986850526 5:11807363-11807385 TCTGGGAGGCAGAAGGTAGTAGG - Intronic
987853712 5:23390550-23390572 GCTGGAGTGCAGAAGGTGAAGGG - Intergenic
988007515 5:25436251-25436273 ACTGGGAAGCAGCAGGTGAGTGG + Intergenic
989266017 5:39474975-39474997 ACTGGGATACAGAAGGTGTAGGG + Intergenic
990096980 5:52128111-52128133 GCTGGGATTCTGATTGTGATTGG - Intergenic
990612156 5:57468515-57468537 GCTGCACTGCAGGAGGTGATCGG - Intergenic
990794007 5:59519488-59519510 GCTGTGATGCAGAACATGCTTGG + Intronic
993509586 5:88754899-88754921 GCAGGGAGGCAGAAGGTGTTAGG - Intronic
996384979 5:122901517-122901539 GCTGGTATGCAGGAGGTATTTGG + Intronic
1000798455 5:165693673-165693695 CCTGGGAAGCAGAAGGTGTCAGG - Intergenic
1001042631 5:168347910-168347932 GCTGGGAAGGAGAAGCAGATGGG + Intronic
1001134814 5:169093480-169093502 GGTGGGAGACAGAAGCTGATTGG + Intronic
1001928498 5:175656961-175656983 GCTGCGATGCAGAGGATGAGGGG - Intergenic
1002875413 6:1205154-1205176 GCTGGGATACAGTGGGTGCTGGG - Intergenic
1002875417 6:1205171-1205193 GCTGGGATGAAGTGGGTGCTGGG - Intergenic
1002875429 6:1205222-1205244 GCTGGGATGAAGTGGGTGCTGGG - Intergenic
1002875441 6:1205273-1205295 GCTGGGATGAAGTGGGTGCTGGG - Intergenic
1002875449 6:1205307-1205329 GCTGGGATACAGTGGGTGCTGGG - Intergenic
1002875465 6:1205375-1205397 GCTGGGATACAGTGGGTGCTGGG - Intergenic
1002875469 6:1205392-1205414 GCTGGGATACAGTGGGTGCTGGG - Intergenic
1002875481 6:1205443-1205465 GCTGGGATACAGTGGGTGCTGGG - Intergenic
1002875485 6:1205460-1205482 GCTGGGATACAGTGGGTGCTGGG - Intergenic
1002875493 6:1205494-1205516 GCTGGGATACAGTGGGTGCTGGG - Intergenic
1002875497 6:1205511-1205533 GCTGGGATGAAGTGGGTGCTGGG - Intergenic
1002875505 6:1205545-1205567 GCTGGGATGAAGTGGGTGCTGGG - Intergenic
1002875513 6:1205579-1205601 GCTGGGATGAAGTGGGTGCTGGG - Intergenic
1002875521 6:1205613-1205635 GCTGGGATACAGTGGGTGCTGGG - Intergenic
1002875541 6:1205698-1205720 GCTGGGATACAGTGGGTGCTGGG - Intergenic
1002875561 6:1205783-1205805 GCTGGGATAGAGCAGGTGCTGGG - Intergenic
1002923451 6:1590307-1590329 CCAGGGATGCAGAAGGTGTTTGG + Intergenic
1003495202 6:6657673-6657695 GCTGGGAGGCATAATCTGATTGG - Intergenic
1004659087 6:17693973-17693995 GCTGGGAAGCAAAATGAGATGGG - Intronic
1005723676 6:28627772-28627794 GCTGGGAGGCTGAAGAAGATGGG + Intergenic
1006084308 6:31585596-31585618 ACTGTGATGGAGAAGGAGATGGG - Intergenic
1006507883 6:34502081-34502103 GCTGGGATGGAGAAGTACATTGG + Intronic
1006964353 6:37967399-37967421 GCTGGGATGCAGAAAGTACAAGG - Intronic
1007499072 6:42281601-42281623 GCTGGTCTGGAGAAGGGGATTGG - Intronic
1009418914 6:63443590-63443612 GCTGGGAGGCAGCAGGTGCTGGG - Intergenic
1009545487 6:65014536-65014558 TGTGGGATACAGAAGGGGATGGG + Intronic
1009946390 6:70346703-70346725 GCTTGGAGGCAGCAGGTGAAGGG + Intergenic
1010400997 6:75445635-75445657 GCTAGGATGTAGTAGGTGCTGGG - Intronic
1011741911 6:90370043-90370065 GCTGATATGGAGAAGGCGATGGG - Intergenic
1011766194 6:90622994-90623016 TCTGGGAAGCACAAGGGGATGGG + Intergenic
1013280836 6:108635601-108635623 GCTGAGCTGCAGGAGGTGCTGGG + Intronic
1015165410 6:130195834-130195856 CCTAGGATGTAGAAGGTGTTGGG - Intronic
1015201565 6:130587319-130587341 GCTGGGAACAAGAAAGTGATGGG - Intergenic
1017239847 6:152155883-152155905 GCTGGGATGCTGAAACAGATAGG - Intronic
1017803815 6:157925372-157925394 GCTGGGATTCATAACGTGTTGGG + Intronic
1018202642 6:161410039-161410061 GCTAGGATGCAAAAGATCATAGG + Intronic
1018874111 6:167804724-167804746 GCTCTGCTGCAGCAGGTGATGGG - Intergenic
1019486327 7:1291069-1291091 GGGGGGATGCAGAAGGGGATGGG - Intergenic
1022146486 7:27547134-27547156 GCTGGAAAGCAGCAAGTGATGGG - Intronic
1022374067 7:29797065-29797087 TCTGGGAGGCAGAAGGTCAATGG + Intergenic
1022404480 7:30074819-30074841 GCTGGGAAGAAGAGGGTGGTGGG - Intronic
1022476395 7:30713469-30713491 GCAGGGATGCAGGACTTGATGGG - Intronic
1022502666 7:30892458-30892480 GCTGGTATGGAGAATGTGGTAGG + Intergenic
1022521908 7:31013861-31013883 GGTGGGATGCATAAGGTGAATGG - Intergenic
1023525108 7:41093946-41093968 GCTGGGAAACAGAAGATGAAAGG + Intergenic
1023733509 7:43214898-43214920 GCTGGGAGGCAGCGGGTGAGGGG + Intronic
1024074257 7:45810728-45810750 GCTGGGAGGCAGGAGGAGCTGGG - Intergenic
1024747611 7:52426717-52426739 GGTGGGAGGGAGAAGGTGAGAGG - Intergenic
1025703076 7:63837845-63837867 GCAGGGATGCACAAAGTGAGTGG + Intergenic
1026307420 7:69154137-69154159 GGTGGAAGGCAGAAGGTGAAAGG + Intergenic
1026338465 7:69414914-69414936 GGTGGGAGGCAGAAGATGAGGGG - Intergenic
1030428214 7:109407434-109407456 AATGGGATGCAGACAGTGATAGG + Intergenic
1030511822 7:110492261-110492283 GCTGGGATGCAGAAAGTAAGTGG + Intergenic
1030761101 7:113352742-113352764 GTTGGGAGCCAGAATGTGATGGG + Intergenic
1032083732 7:128872940-128872962 GCAGGACTGCAGAAGGTGACAGG + Intronic
1033563987 7:142560981-142561003 GCTGGGAGGTAGAAGGAGAAGGG - Intergenic
1034961032 7:155364548-155364570 GCAGAGAAGCAGAAGGTGCTGGG - Intronic
1035004858 7:155648828-155648850 GATGGAAGCCAGAAGGTGATAGG - Intronic
1035458914 7:159027379-159027401 GATGGGAGGCAGAAGGTGCAGGG - Intergenic
1037529041 8:19756733-19756755 GCTGGGATGGAGAGGGTGGAGGG - Intronic
1037753834 8:21699041-21699063 GCTATGAGGGAGAAGGTGATTGG - Intronic
1039410414 8:37350178-37350200 GCTGGGATGCAGAGAGAGGTGGG - Intergenic
1041952863 8:63523976-63523998 GCTGACATGCAGTAGGTGCTTGG - Intergenic
1042401505 8:68353953-68353975 CCTCAGATGCAGAAGGGGATTGG - Intronic
1042604601 8:70532943-70532965 GCTGAGATGCATAGGGTGAGTGG + Intergenic
1049194274 8:141307264-141307286 GCTGAGACGCAGAAGGTGCGGGG + Intronic
1049372228 8:142273391-142273413 TCCAGGAGGCAGAAGGTGATGGG - Intronic
1050652769 9:7791125-7791147 TCTGGGAGGCAGAAGGCCATTGG + Intergenic
1052720446 9:32166743-32166765 CCTAGGATGTAGAAGGTGTTGGG + Intergenic
1053138472 9:35666570-35666592 CCTGGGGTGCAGTTGGTGATGGG + Intronic
1053157781 9:35792259-35792281 GCTGGGATGCAGAAGGTGCTGGG - Exonic
1053901058 9:42795930-42795952 GCTATGTTGAAGAAGGTGATGGG + Intergenic
1054260587 9:62861634-62861656 GCTATGTTGAAGAAGGTGATGGG - Intergenic
1054797585 9:69316942-69316964 GCTGGGATGGGGAGGGTGAGTGG - Intergenic
1056502744 9:87225845-87225867 ACTGGCAGGCAGAAGGTGAGTGG - Intergenic
1056656118 9:88510717-88510739 GCTAGGGTGGAGCAGGTGATTGG - Intergenic
1057185268 9:93053908-93053930 CCTGGCATGCAGTAGGTGTTTGG + Intergenic
1059024279 9:110607551-110607573 GCAGAGATGCAGAAGCTGTTGGG - Intergenic
1059056351 9:110985095-110985117 GCTGGGATGAAGGAGGCTATGGG + Intronic
1060041805 9:120306803-120306825 GCAGTGATGCAGAAGCTGATGGG - Intergenic
1060815903 9:126635021-126635043 GCTGGCATGCAGCGGGTGCTAGG - Intronic
1060859639 9:126944029-126944051 GCTGGGTTGGAGCAGGTAATGGG + Intronic
1061213915 9:129209277-129209299 GCTGGGTTGAGGAAGCTGATTGG + Intergenic
1061666280 9:132162379-132162401 GCTCGGATGCAAAAGTTGTTTGG + Intronic
1187622950 X:21078898-21078920 GCTGGGCTGGAGATGGTGGTGGG + Intergenic
1187775685 X:22754054-22754076 GCTGGGATGGAAAAGGTAAATGG + Intergenic
1188463183 X:30451314-30451336 CCTAGGATGTAGAAGGTGTTGGG + Intergenic
1189104240 X:38220436-38220458 GCCCGGACGCAGAAGGTGCTAGG + Intronic
1189759427 X:44306091-44306113 GCTGGGAGGCATAATCTGATTGG - Intronic
1190026157 X:46925210-46925232 CCTGGGAAGGAGAATGTGATAGG - Intronic
1190114326 X:47616300-47616322 TCTGAGATGCAGAAGGGGAAGGG + Intronic
1190328968 X:49224163-49224185 GCTGGGATAGAGGAGGGGATGGG + Intronic
1192582811 X:72299168-72299190 GCTGGGAGGCAGATGATGGTGGG - Intronic
1192868704 X:75164257-75164279 GTTGGAAAGCAGAAGGTGAAAGG - Intergenic
1195466941 X:105189889-105189911 GCTGGGATGAAGAAGAGTATAGG + Intronic
1196711760 X:118770386-118770408 GGTGGGTTGCAGAACTTGATGGG - Intronic
1200409759 Y:2849568-2849590 GCTGGAGGACAGAAGGTGATGGG + Intronic
1200858005 Y:7960110-7960132 ACTTGTATTCAGAAGGTGATGGG - Intergenic
1201072956 Y:10166005-10166027 CCTGGGATGCAGAAGGGGTCAGG - Intergenic
1201391442 Y:13501918-13501940 GCTGGAACCCAGACGGTGATTGG + Intergenic