ID: 1073783479

View in Genome Browser
Species Human (GRCh38)
Location 10:106864431-106864453
Sequence TCTAACACACAGAGCTAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073783475_1073783479 -7 Left 1073783475 10:106864415-106864437 CCACCATGGCCTTTAGTCTAACA 0: 1
1: 1
2: 4
3: 61
4: 200
Right 1073783479 10:106864431-106864453 TCTAACACACAGAGCTAAGTGGG No data
1073783473_1073783479 -1 Left 1073783473 10:106864409-106864431 CCCACTCCACCATGGCCTTTAGT 0: 1
1: 1
2: 48
3: 100
4: 394
Right 1073783479 10:106864431-106864453 TCTAACACACAGAGCTAAGTGGG No data
1073783469_1073783479 10 Left 1073783469 10:106864398-106864420 CCCCATGTGAACCCACTCCACCA 0: 1
1: 10
2: 34
3: 85
4: 301
Right 1073783479 10:106864431-106864453 TCTAACACACAGAGCTAAGTGGG No data
1073783471_1073783479 8 Left 1073783471 10:106864400-106864422 CCATGTGAACCCACTCCACCATG 0: 2
1: 28
2: 50
3: 94
4: 283
Right 1073783479 10:106864431-106864453 TCTAACACACAGAGCTAAGTGGG No data
1073783476_1073783479 -10 Left 1073783476 10:106864418-106864440 CCATGGCCTTTAGTCTAACACAC 0: 1
1: 0
2: 7
3: 51
4: 183
Right 1073783479 10:106864431-106864453 TCTAACACACAGAGCTAAGTGGG No data
1073783468_1073783479 26 Left 1073783468 10:106864382-106864404 CCTCGAGTCAGAAGATCCCCATG 0: 1
1: 0
2: 0
3: 10
4: 120
Right 1073783479 10:106864431-106864453 TCTAACACACAGAGCTAAGTGGG No data
1073783470_1073783479 9 Left 1073783470 10:106864399-106864421 CCCATGTGAACCCACTCCACCAT 0: 1
1: 0
2: 22
3: 42
4: 193
Right 1073783479 10:106864431-106864453 TCTAACACACAGAGCTAAGTGGG No data
1073783467_1073783479 27 Left 1073783467 10:106864381-106864403 CCCTCGAGTCAGAAGATCCCCAT 0: 1
1: 0
2: 0
3: 12
4: 92
Right 1073783479 10:106864431-106864453 TCTAACACACAGAGCTAAGTGGG No data
1073783474_1073783479 -2 Left 1073783474 10:106864410-106864432 CCACTCCACCATGGCCTTTAGTC 0: 1
1: 1
2: 44
3: 97
4: 309
Right 1073783479 10:106864431-106864453 TCTAACACACAGAGCTAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073783479 Original CRISPR TCTAACACACAGAGCTAAGT GGG Intronic
No off target data available for this crispr