ID: 1073784275

View in Genome Browser
Species Human (GRCh38)
Location 10:106871497-106871519
Sequence TTATCCAGTCTGTAGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6868
Summary {0: 1, 1: 0, 2: 48, 3: 930, 4: 5889}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073784275_1073784280 28 Left 1073784275 10:106871497-106871519 CCCACCAACTACAGACTGGATAA 0: 1
1: 0
2: 48
3: 930
4: 5889
Right 1073784280 10:106871548-106871570 ATGCTATACAGCCATCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073784275 Original CRISPR TTATCCAGTCTGTAGTTGGT GGG (reversed) Intronic
Too many off-targets to display for this crispr