ID: 1073785054

View in Genome Browser
Species Human (GRCh38)
Location 10:106879839-106879861
Sequence GCCTCCCCAGAGCCCCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073785050_1073785054 25 Left 1073785050 10:106879791-106879813 CCTTAGGACCTGGATGTGCCAAT 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1073785054 10:106879839-106879861 GCCTCCCCAGAGCCCCCAGATGG No data
1073785053_1073785054 0 Left 1073785053 10:106879816-106879838 CCTGAATCAGCACAGAAGAGAAT 0: 1
1: 0
2: 1
3: 22
4: 248
Right 1073785054 10:106879839-106879861 GCCTCCCCAGAGCCCCCAGATGG No data
1073785051_1073785054 17 Left 1073785051 10:106879799-106879821 CCTGGATGTGCCAATAACCTGAA 0: 1
1: 0
2: 1
3: 31
4: 147
Right 1073785054 10:106879839-106879861 GCCTCCCCAGAGCCCCCAGATGG No data
1073785052_1073785054 7 Left 1073785052 10:106879809-106879831 CCAATAACCTGAATCAGCACAGA 0: 1
1: 0
2: 0
3: 19
4: 252
Right 1073785054 10:106879839-106879861 GCCTCCCCAGAGCCCCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073785054 Original CRISPR GCCTCCCCAGAGCCCCCAGA TGG Intronic
No off target data available for this crispr