ID: 1073788449

View in Genome Browser
Species Human (GRCh38)
Location 10:106915558-106915580
Sequence CAATGTGACTAGAGTAGAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073788449_1073788454 15 Left 1073788449 10:106915558-106915580 CCCACTCTACTCTAGTCACATTG 0: 1
1: 0
2: 3
3: 20
4: 177
Right 1073788454 10:106915596-106915618 CTCTTTCTTGTTGTGCTTCTTGG No data
1073788449_1073788455 25 Left 1073788449 10:106915558-106915580 CCCACTCTACTCTAGTCACATTG 0: 1
1: 0
2: 3
3: 20
4: 177
Right 1073788455 10:106915606-106915628 TTGTGCTTCTTGGATCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073788449 Original CRISPR CAATGTGACTAGAGTAGAGT GGG (reversed) Intronic
901598279 1:10402195-10402217 TAATGTGTCTAGAAGAGAGTGGG - Intronic
902242595 1:15098977-15098999 CAATGTGACTGGTGCAGAGATGG + Intronic
902706190 1:18206650-18206672 CAATGTAGCTGGAGCAGAGTGGG + Intronic
903456706 1:23492447-23492469 CAATGTGACTGGAGCAGGGGAGG - Intergenic
909761844 1:79298155-79298177 CAGTGTGTCTAGAGTAGAGGTGG + Intergenic
910002174 1:82354247-82354269 CCATGTGGCTATAGCAGAGTGGG - Intergenic
910846483 1:91609579-91609601 CAATGTCACTACACTAGAGCTGG + Intergenic
911807007 1:102222964-102222986 CAGTGTGGCTAGAGTAAAGCAGG + Intergenic
912079510 1:105917577-105917599 CATTTTGACTAGAGTAGTCTCGG + Intergenic
912802006 1:112725573-112725595 AAATCTGACTAGAGGAGGGTAGG - Intronic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915836477 1:159180642-159180664 CAGTGAAACTAGAGTAGTGTGGG + Intronic
917120261 1:171639333-171639355 CAATGTGCCTACCTTAGAGTAGG + Intronic
919236032 1:194843743-194843765 CACTGTGATTACAGCAGAGTTGG + Intergenic
919442151 1:197649175-197649197 CAATGTGACCAGAATAGAGGAGG + Intronic
921240067 1:213170642-213170664 CAAGGAGGCTAGAGGAGAGTAGG + Intronic
923754222 1:236775718-236775740 CTGTGTGACTAGAGTAGTTTGGG - Intergenic
923884770 1:238142138-238142160 AAATATGCCTAGATTAGAGTAGG + Intergenic
1063304979 10:4889371-4889393 AAACTTGACTATAGTAGAGTAGG + Intergenic
1065245452 10:23751557-23751579 CAAGGGGACTAGGGAAGAGTTGG - Intronic
1067687479 10:48475899-48475921 CAGTGTGGCCAGAGCAGAGTGGG - Intronic
1067743557 10:48915066-48915088 GATTGTGAGTAGAGTAGAGCTGG - Intronic
1073788449 10:106915558-106915580 CAATGTGACTAGAGTAGAGTGGG - Intronic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1078251071 11:9617010-9617032 CAGTGTGACAGGAGTGGAGTGGG + Intergenic
1079466278 11:20734174-20734196 CATGGTGACTAAAGTAGAGAAGG + Intronic
1081427251 11:42938846-42938868 CAATGTGGCTAGAGCAGAGTTGG - Intergenic
1082026164 11:47573927-47573949 GAAAGTGACTAGAGGAGAGTTGG - Intronic
1085645595 11:78220300-78220322 CAAGGTGCCTGGAGTAGAGTTGG - Exonic
1087286587 11:96270923-96270945 CAGTGTGGCTAGAGTAAAGCAGG + Intronic
1087458238 11:98414420-98414442 CAATTTGATTAGTGTTGAGTTGG - Intergenic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1087825035 11:102755367-102755389 CAATGTGGCTGGAGCAGAGTGGG + Intergenic
1088397387 11:109383328-109383350 CAATTTGGCTAGAGTTGAGGGGG + Intergenic
1093441193 12:19198293-19198315 CTCTGTGACTAGAGTATGGTAGG - Intronic
1093647885 12:21609870-21609892 CAGTGTGTCTAGACTAGAGAAGG + Intergenic
1096670771 12:53197110-53197132 AAATTTGAATAGAGGAGAGTTGG + Intronic
1098241130 12:68468186-68468208 AACTGTGACTTCAGTAGAGTAGG - Intergenic
1098663708 12:73132951-73132973 CAATATGTCTTGAGTTGAGTTGG + Intergenic
1099560252 12:84164418-84164440 CAATGTGGCTAGAGTCAAGGAGG + Intergenic
1099583449 12:84483844-84483866 CAGTGTGACTAGAATAAAGCAGG + Intergenic
1099780249 12:87184380-87184402 CAATGTGGCTCAAGTAGAATTGG - Intergenic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1102200947 12:111057359-111057381 CTATGTGAGTGGAGTGGAGTGGG + Intronic
1102222416 12:111203587-111203609 CCATGTGCCTGGAGCAGAGTGGG + Intronic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1108782835 13:53857650-53857672 CAGTGTGGCTAGAGCAGATTGGG + Intergenic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1111454442 13:88461981-88462003 CAATGAGACTGGAATAGGGTAGG - Intergenic
1112378708 13:98868142-98868164 CAGGGTGACTAGAATAGAGTAGG - Intronic
1115305295 14:31927697-31927719 CCATGTGACTAGGGCAGAGATGG - Intergenic
1116232067 14:42229663-42229685 CACTGAGAGTAGAGTAGAGATGG - Intergenic
1116443038 14:44976475-44976497 CAATGTGCTCAGAGTATAGTGGG - Intronic
1119004676 14:70912797-70912819 CAGTGTGACTACAGCACAGTGGG - Intronic
1119876683 14:78065797-78065819 CAATGTGTCTAGGAAAGAGTAGG + Intergenic
1121240596 14:92427337-92427359 CAGTGTGGCCAGAGTAGAGTGGG + Intronic
1130767930 15:86891695-86891717 CCATGTCACTTGAGTAGAGAAGG - Intronic
1133772938 16:8878248-8878270 CAATGTGGCTGGAGTAGGGAGGG + Intergenic
1137959830 16:52871352-52871374 CAAAGTTACCAGAGTAGAATAGG - Intergenic
1138197210 16:55060501-55060523 CCATGTGGCTGGAGCAGAGTGGG - Intergenic
1138981912 16:62280192-62280214 CAAGGTGATTAGAGGAGAATTGG + Intergenic
1140656319 16:77143701-77143723 CCTTGTGCCTAGGGTAGAGTTGG - Intergenic
1142490842 17:278430-278452 CAGTGTGACTTGAGTTAAGTTGG - Intronic
1142779451 17:2169643-2169665 CAATGTGACTAGAGCACACTGGG + Intronic
1144347427 17:14362048-14362070 CACAGTGACTAGAATATAGTAGG + Intergenic
1144520388 17:15948768-15948790 CAATGTGGCAAGAGCAGAGAGGG - Intronic
1144743861 17:17600125-17600147 CACTGTTGCTTGAGTAGAGTTGG + Intergenic
1146582947 17:34055918-34055940 CATTGGGAATAGAGTAGAGGGGG + Intronic
1147542799 17:41374987-41375009 CAATGGGAATAGAGTTGAGCTGG + Intronic
1149211801 17:54312016-54312038 TAAGGTGAGAAGAGTAGAGTAGG - Intergenic
1149694453 17:58605601-58605623 CCCTGTGACTTGAGTGGAGTGGG - Intronic
1151499493 17:74479943-74479965 CATTGTGACTGGGGTAGACTGGG + Intronic
1156816366 18:41316410-41316432 CAATCAGGCTAGAGTACAGTGGG - Intergenic
1157007827 18:43607015-43607037 CAACGTGACTAGAGTGGTGCAGG + Intergenic
1157430441 18:47620051-47620073 CTATGTGAGTAGAGTGGGGTGGG + Intergenic
1158349335 18:56549213-56549235 AAACCTGACTAGAGTTGAGTTGG + Intergenic
1158580458 18:58676461-58676483 ACATGTGACCAGAGTAGAGAGGG - Intronic
1158725391 18:59967449-59967471 CAATATGCCTAGAGTAGTGCGGG + Intergenic
1161990789 19:7682949-7682971 GAATGTGTTTACAGTAGAGTGGG + Exonic
1162592666 19:11602857-11602879 CACTGTGAGGAGAGGAGAGTGGG + Intronic
1163068353 19:14816406-14816428 CAGTGTGGCTAGAATAGAGCAGG + Intronic
1164771732 19:30815030-30815052 CAGTGTGACTAGAGAGGAGGAGG + Intergenic
1165984467 19:39755925-39755947 CACTGTGTCTGGAGTAGAGGGGG - Intergenic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
926371671 2:12184944-12184966 CAATTTGACTGCAGTGGAGTGGG + Intergenic
926796531 2:16624062-16624084 CATTGTGACTAGTGGAGAATAGG - Intronic
928353478 2:30585432-30585454 GAATGTGGCTAGACTAGAGAGGG - Intronic
930889035 2:56361666-56361688 CAATGTGGCTGGAACAGAGTGGG + Intronic
931001300 2:57786255-57786277 CAATGCCAGTAGAATAGAGTGGG + Intergenic
931975291 2:67637578-67637600 GAAAGTGGCTAGAGGAGAGTAGG - Intergenic
933005347 2:76985881-76985903 GAATGTTAGTGGAGTAGAGTGGG - Intronic
933208377 2:79536650-79536672 GAAAGTGACGACAGTAGAGTAGG - Intronic
934767202 2:96886299-96886321 CAATGTGACTGGCTTAGAGACGG + Intronic
936432292 2:112475014-112475036 GAATGTGGCTAGAGCAGAGCTGG - Intergenic
938309710 2:130281016-130281038 CTATATTACTAGAGTGGAGTAGG - Intergenic
939220083 2:139290712-139290734 CACTGTGCCTAGGGTAGAGGGGG - Intergenic
947275101 2:228381894-228381916 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
948278008 2:236724900-236724922 CAATGAGACTGGAGAAGAATGGG + Intergenic
1169275336 20:4229970-4229992 CAATGTGGCTGGAACAGAGTAGG - Intronic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174392297 20:50225194-50225216 CCATGTGGCTGGAGTAGAATGGG + Intergenic
1174424850 20:50424708-50424730 CAAGGTGACTAGTCTAGAGAGGG - Intergenic
1175597057 20:60243687-60243709 CAATGAGGTCAGAGTAGAGTGGG - Intergenic
1176983314 21:15407875-15407897 CATTGTGATTAGGGTAGACTGGG - Intergenic
950004072 3:9680137-9680159 CAAGCTGTCCAGAGTAGAGTTGG + Intronic
950874923 3:16263176-16263198 CAGTGTGACCAGAGCAGAGCAGG - Intronic
958905802 3:99940897-99940919 AACTGTGACTAGAATAGAGATGG + Intronic
959868777 3:111302777-111302799 CAATGTGGCTAGAATAAAGCAGG - Intronic
960444896 3:117735855-117735877 CAGTGTGACTGGACTAGAATGGG - Intergenic
962350048 3:134650070-134650092 CAATGTGAATGGAGTACAGAGGG - Intronic
962449493 3:135500792-135500814 CAGTGTGGCTAGAGTACAGCAGG + Intergenic
962849392 3:139296648-139296670 CATTCTGACCAGAGCAGAGTGGG - Intronic
964533724 3:157696510-157696532 CAAGGTGACTAGAGTGGATATGG - Intergenic
969895734 4:10302817-10302839 CAATGGGACAAGAGTTGAGCAGG - Intergenic
970457034 4:16234601-16234623 CATTTTGACTTGAGGAGAGTGGG + Intergenic
973212791 4:47635555-47635577 CAATGTGTCTAAAGTTTAGTGGG + Intronic
974698415 4:65405511-65405533 CAATGTGACTAAAATAGAAAGGG - Intronic
975785395 4:77882188-77882210 CTACATGACTAGAGCAGAGTTGG - Intronic
977449055 4:97171218-97171240 CAGTGTGGCTAGAATAAAGTAGG - Intergenic
980312394 4:131148406-131148428 CAATATGAGCAGAGTAGATTGGG + Intergenic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
981637806 4:146900043-146900065 ATATGTGACTAGAGTGGAGTGGG - Intronic
983769193 4:171526905-171526927 CTATGGTACTAGACTAGAGTTGG - Intergenic
983785117 4:171720558-171720580 CAATGTGGCTAGAATAAAGCAGG + Intergenic
985164778 4:187081859-187081881 CAATGTGCCTGGAGTCAAGTAGG - Intergenic
986223283 5:5789548-5789570 CAGTGTGACTATATTAGAGATGG - Intergenic
986557461 5:9025845-9025867 GAATTTGACTGGAGTGGAGTAGG - Intergenic
987231456 5:15897864-15897886 CAATGGGAATGGACTAGAGTTGG + Intronic
990393927 5:55356102-55356124 ATATGTGACAAGAGTAGAGGTGG - Intronic
991251220 5:64563415-64563437 AAATCTTACTGGAGTAGAGTGGG + Intronic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
994994171 5:107038611-107038633 AAATGTAACTAGAGTAAAGGAGG - Intergenic
996036051 5:118759914-118759936 CAGTGTGGCTAGAGTAAAGCAGG - Intergenic
996836754 5:127802165-127802187 CAATGTCCCTAGAGTCTAGTGGG - Intergenic
998336927 5:141381489-141381511 CAATTACACTAGAATAGAGTAGG + Intronic
1000040254 5:157479976-157479998 GAGTGTGACCAGAGTAGACTTGG - Exonic
1000516724 5:162244952-162244974 CAAAGTGCCTAGTATAGAGTAGG - Intergenic
1001961647 5:175883497-175883519 CCTTGTGGCTAGAGTACAGTGGG + Exonic
1001975245 5:175993497-175993519 CAGTGTGGCTTGAGTGGAGTGGG - Intronic
1002242186 5:177850273-177850295 CAGTGTGGCTTGAGTGGAGTGGG + Intergenic
1003412490 6:5877760-5877782 CAATGCCACTAGAGAAGATTCGG - Intergenic
1003708472 6:8562107-8562129 CCATGTGGCTGGAGTAGAGGAGG - Intergenic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1005594441 6:27365879-27365901 CAATGTGAATAGAGCAAAGAAGG + Intergenic
1006811117 6:36821237-36821259 CCGTGTGACTGGAGTGGAGTGGG + Intronic
1012526916 6:100188894-100188916 CCAAGTGACTAAAGCAGAGTAGG - Intergenic
1014007870 6:116442202-116442224 CAGTGTGGCTAGAGCAGAGTGGG + Intergenic
1016063130 6:139650903-139650925 TAAGGTGACTAGAGCGGAGTGGG + Intergenic
1016499110 6:144698947-144698969 CAGTGTGAATAGAGAACAGTTGG - Intronic
1016618632 6:146081335-146081357 CAATGTGTTTAGAGCAGACTGGG + Intronic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017552000 6:155518878-155518900 CAAGATGACTAGTGTAGACTAGG - Intergenic
1018155260 6:160979768-160979790 AAAAGTGCCTAGAGTGGAGTGGG - Intergenic
1018341148 6:162852254-162852276 CCATCTGACTAGAGTAGGGTGGG + Intronic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1024132170 7:46364258-46364280 CACTGTGATTAGAGGAAAGTGGG - Intergenic
1027597756 7:80196862-80196884 AATTGTTACTATAGTAGAGTAGG + Intronic
1027669826 7:81082126-81082148 CATAGTGAGTAGAGTACAGTTGG - Intergenic
1027926073 7:84465765-84465787 CAAAATGAGTAGAGTAGATTTGG - Intronic
1029075926 7:97934106-97934128 CAGTCTGACTGGAGGAGAGTGGG + Intergenic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1030318501 7:108140691-108140713 CAATGTGGCTAGAGCAGAGTGGG + Intergenic
1030666504 7:112284748-112284770 TAATGTGACTAGAGTATGTTTGG + Intronic
1030855310 7:114548589-114548611 TAATGTGACTAAAGTTCAGTGGG + Intronic
1035955191 8:4069711-4069733 CAAGGTGCCTAGAGTTTAGTGGG - Intronic
1037162867 8:15793937-15793959 CAGTGTGGCTAGAGCAAAGTGGG + Intergenic
1037995761 8:23351298-23351320 TGATGTGACTAGGGCAGAGTGGG - Intronic
1039314662 8:36357863-36357885 GAATGTGACCAGACAAGAGTAGG + Intergenic
1041120251 8:54579427-54579449 CAACGTGACAAGAGAGGAGTTGG - Intergenic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1043614023 8:82103355-82103377 CAGTGTGGCTAGAATAAAGTGGG + Intergenic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1045845033 8:106624324-106624346 TAATGAGACTGGAGTAGGGTAGG + Intronic
1046173573 8:110545643-110545665 CCATGTGACTGCAGTAGAGTTGG - Intergenic
1047175287 8:122535039-122535061 CAAAGTGACTAGAGATCAGTGGG + Intergenic
1047669965 8:127135454-127135476 CAAGGTGTCTAGAACAGAGTAGG + Intergenic
1048293240 8:133196159-133196181 CACTGTGCCCAGAGTAGAGTGGG - Intronic
1050221637 9:3397603-3397625 CAAGGTGACAGGAGTAGACTTGG + Intronic
1050587050 9:7123789-7123811 GAATTTGACAAGAGTAGAGTCGG + Intergenic
1050763249 9:9099847-9099869 CAATGTGAATTAATTAGAGTTGG + Intronic
1050814624 9:9794468-9794490 CAATGTGGCTAGAGCAGAGAAGG + Intronic
1051033114 9:12707545-12707567 AACTGTGGCTGGAGTAGAGTGGG + Intronic
1051796573 9:20878616-20878638 AAATGTGACTAAAATAGATTTGG - Intronic
1052125461 9:24769272-24769294 CAATGAGACTAGAGTAGACCTGG + Intergenic
1052982691 9:34460362-34460384 CAATGTACCTAGACTTGAGTGGG - Intronic
1055249585 9:74286988-74287010 CAATGTGGCTGGAGCAGGGTGGG - Intergenic
1055963604 9:81843965-81843987 CAAGGTGACTCGAGCAGAGAAGG + Intergenic
1059600390 9:115770964-115770986 TAATGTGACCAAAGCAGAGTAGG + Intergenic
1186920673 X:14275940-14275962 GAGTTTGACTAGTGTAGAGTAGG - Intergenic
1187358008 X:18596691-18596713 AAATGTGAATAGAATAAAGTAGG + Intronic
1188630327 X:32349542-32349564 GAATGTGACTGGAGAAGGGTAGG - Intronic
1190097677 X:47494887-47494909 CAATGTGACTACAGAAGCGGAGG - Intergenic
1192302084 X:69915649-69915671 CAAAGTGACCAGTGCAGAGTAGG - Intronic
1194814103 X:98421761-98421783 CAATGTAAGTAGACTGGAGTAGG + Intergenic
1198132770 X:133715116-133715138 CAGTGTGACTAGAATAAAGCAGG + Intronic
1199243638 X:145576905-145576927 CTATGTGGCTAGAGGAGAGAAGG + Intergenic
1200760912 Y:7038422-7038444 AAATGTGAGGAGAGTAGAGCTGG + Intronic
1200943954 Y:8813270-8813292 GATAGTGACTAGAATAGAGTTGG - Intergenic
1201695691 Y:16822794-16822816 CAATGTGACTTGAGGGGAGTAGG - Intergenic