ID: 1073792784

View in Genome Browser
Species Human (GRCh38)
Location 10:106956713-106956735
Sequence CAACCTTTCCCCAGTCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073792784_1073792786 11 Left 1073792784 10:106956713-106956735 CCACACTGACTGGGGAAAGGTTG 0: 1
1: 0
2: 2
3: 30
4: 188
Right 1073792786 10:106956747-106956769 TGCCTTCCACTGAATTGCTTAGG 0: 1
1: 0
2: 1
3: 16
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073792784 Original CRISPR CAACCTTTCCCCAGTCAGTG TGG (reversed) Intronic
900387879 1:2418886-2418908 CAGCATTTCCCCACCCAGTGTGG - Intergenic
900950114 1:5853848-5853870 CATCCTTTCCCCTTTCAGTCAGG - Intergenic
901207739 1:7506340-7506362 CAACCTTCCCCCTGGGAGTGGGG - Intronic
901742886 1:11353828-11353850 AAACCATTCCCAAGCCAGTGTGG - Intergenic
901879285 1:12184725-12184747 AAACCCTTCCCCAGCCAGGGTGG + Intronic
902657153 1:17877115-17877137 CATCCTTTCCTGATTCAGTGAGG + Intergenic
906864069 1:49396930-49396952 CAATTTTTCCGCAGACAGTGGGG + Intronic
909374837 1:74927955-74927977 CAGCATTTGCCCATTCAGTGTGG - Intergenic
909708476 1:78615651-78615673 CAACCTTTGTCCATTCAGTATGG + Intergenic
910934838 1:92479318-92479340 CCACCTCCCCCCAGCCAGTGTGG + Intronic
910987329 1:93018329-93018351 CCACCTTACCCCAGTCAGAATGG + Intergenic
911437921 1:97886478-97886500 CAATCTCTACCCAGTAAGTGAGG - Intronic
911966572 1:104379835-104379857 CAACTTTTCCCCAAACTGTGAGG - Intergenic
912112594 1:106361837-106361859 CAACTTTTGCCCATTCAGTATGG + Intergenic
913155023 1:116087947-116087969 CAACTTTTCCCCACTCAGTATGG + Intergenic
915829966 1:159118503-159118525 CAAGCTGTCCACTGTCAGTGAGG + Intronic
918501082 1:185197052-185197074 CAGCTTTTGCCCATTCAGTGTGG + Intronic
918710837 1:187727843-187727865 CATCCTTTCCCCACTAAGTGGGG - Intergenic
920446275 1:206021092-206021114 CAATCTTTCTCCATTCAGTATGG - Exonic
920584822 1:207147408-207147430 CAACTTTTCCCCATTTAGTATGG + Intergenic
921379689 1:214512007-214512029 CAGCCTTTCCCCAGTCAGCAAGG - Intronic
923005727 1:230048163-230048185 CAGTCTCTCTCCAGTCAGTGAGG - Intergenic
923558229 1:235018654-235018676 CAACCTTTTCTCAGGCAGTATGG - Intergenic
1062797103 10:352778-352800 CCACCTTTCCCCACCCCGTGTGG + Intronic
1067777243 10:49172516-49172538 AACCCTTTCCCCAGTGAGTAGGG - Intronic
1068011069 10:51452390-51452412 CAACTTTTCCCCATTCAGTGTGG + Intronic
1068326247 10:55491491-55491513 CCACCTTTACCTAGTTAGTGGGG + Intronic
1068730822 10:60356366-60356388 CAATCTTTCCAGAGTCAGTAGGG - Intronic
1069639781 10:69947191-69947213 AAACCTGTCTCCAGTGAGTGAGG + Intronic
1069829843 10:71276386-71276408 CAAGCCTTCCTCAGTCACTGGGG + Intronic
1070284131 10:75071334-75071356 CAAGCCTTCCCCAGACACTGCGG - Intergenic
1072012386 10:91314080-91314102 AAATCTTTCCACAGTCAGTATGG + Intergenic
1073792784 10:106956713-106956735 CAACCTTTCCCCAGTCAGTGTGG - Intronic
1076187478 10:128460645-128460667 CACCCTTTCCAAAGTCAGTGAGG + Intergenic
1078909399 11:15717078-15717100 CAACCCCTCTCCAGTTAGTGAGG + Intergenic
1080716288 11:34804309-34804331 CAACTTTTCTCCATTCAGTGTGG + Intergenic
1081770122 11:45645125-45645147 CAACAGTTGCCAAGTCAGTGAGG + Intergenic
1082958758 11:58899314-58899336 CAACCGTTTCTCAGTCAGTGTGG + Intronic
1082965433 11:58962194-58962216 CAACTGTTTCTCAGTCAGTGAGG + Intronic
1083165233 11:60880838-60880860 CACTCCTTCCCCAGGCAGTGGGG + Intergenic
1085378499 11:76090164-76090186 GAACCACTCCACAGTCAGTGTGG - Intronic
1086354348 11:85978959-85978981 CTACCATACCCTAGTCAGTGAGG + Intronic
1086611459 11:88761092-88761114 CAGCTTTTACCCAGTCAGTATGG - Intronic
1089549154 11:119257297-119257319 CCACCTTACCCCAGCCAGAGTGG - Intronic
1090184426 11:124727192-124727214 CATCCCTGCCCCAGTCTGTGTGG + Intergenic
1093169193 12:15840487-15840509 CAACCTTTCACAAGACAGTGAGG - Intronic
1093486802 12:19661434-19661456 CAATCTTGCCCCCGTCAGTGGGG + Intronic
1094499146 12:31007431-31007453 CGACCTATCCCAGGTCAGTGAGG - Intergenic
1094798864 12:34006704-34006726 CAGCCTTTACCCATTCAGTATGG - Intergenic
1098247685 12:68537324-68537346 CAATTTTTCCACAGACAGTGGGG + Intergenic
1098631346 12:72726157-72726179 CAACTTTTTTCCATTCAGTGTGG + Intergenic
1103875039 12:124120429-124120451 GAACCTTTCCACATTCAGAGTGG + Intronic
1105417980 13:20229720-20229742 CAATCTTTGCTCGGTCAGTGAGG + Exonic
1106390558 13:29331658-29331680 CAGCTTTTGCCCATTCAGTGTGG + Intronic
1106915554 13:34510320-34510342 CAGTCTTTCCCCAGTTAGCGAGG - Intergenic
1110961261 13:81629188-81629210 CAACTTTTGCCCATTCAGTATGG + Intergenic
1111795804 13:92918195-92918217 GACCCTTTCCCCATTCACTGAGG - Intergenic
1112666794 13:101584559-101584581 CAGGCTTTCCCCAGTCAGTCTGG - Intronic
1114486263 14:23064068-23064090 CCACCTTTCCCCTGACACTGGGG + Intronic
1115041533 14:28936084-28936106 AAACCCTTCACCAGTCAGTCTGG + Intergenic
1115460394 14:33653567-33653589 CAACATTTCCCCAGTGAGCTGGG - Intronic
1116855192 14:49945938-49945960 CAACCTTCTCCCAGTCACTGTGG + Intergenic
1119061829 14:71482481-71482503 CAATTTTTCCCAAGTCAGTGTGG + Intronic
1121793436 14:96716599-96716621 CATCCTTTCCCCAGACAGTAGGG - Intergenic
1123479309 15:20616254-20616276 CAGTCTTTCCCCAGCCAGAGAGG + Intergenic
1123638704 15:22384131-22384153 CAGTCTTTCCCCAGCCAGAGAGG - Intergenic
1124662535 15:31562172-31562194 CAGCCTCTCCCCAGTCAGGGAGG - Intronic
1125771596 15:42171081-42171103 TAACCAGCCCCCAGTCAGTGAGG - Intronic
1127099003 15:55544916-55544938 ATACTTTTCCCCAGTCAGAGCGG + Exonic
1127255891 15:57292610-57292632 CAACTTTTCACCAGTGAGTTAGG - Intronic
1128481209 15:68040530-68040552 CAGCTTTTCCCCATTCAGTATGG - Intergenic
1131333985 15:91529930-91529952 CAACCTTTCCCCTCTCAGTCAGG + Intergenic
1131454052 15:92569592-92569614 CACCCTTTCCCCATTATGTGAGG + Intergenic
1134033683 16:11013291-11013313 CTTCCTTTCCCCATTCAGAGTGG + Intronic
1134044805 16:11093308-11093330 CCACTTTTCCTCAGCCAGTGCGG + Intronic
1134801907 16:17092269-17092291 AAACCTTTCCCCAAACATTGGGG - Intergenic
1135743777 16:24998467-24998489 CCACCTTTCCCCAGTGTCTGAGG - Intronic
1135752583 16:25068832-25068854 CCACCTTTCCCCAGTGTCTGAGG + Intergenic
1136146570 16:28319952-28319974 CACCCTGTCCCCAGTAACTGGGG - Intronic
1140376996 16:74452571-74452593 CAGCCGTTCCCCAGGCTGTGTGG - Intronic
1140658537 16:77165056-77165078 CAACCTTTCCCCAGTTTCTCTGG - Intergenic
1140882612 16:79212319-79212341 GAACCTTGTCCCAGCCAGTGAGG + Exonic
1145254500 17:21315275-21315297 CAACCTTCCCCAAGTAAGAGGGG - Intergenic
1145979424 17:29003048-29003070 CAACCTTACCCCAGTCTCAGCGG + Intronic
1148046670 17:44748969-44748991 CACCCTTTCCCCAGCCAGGAGGG - Intronic
1148731346 17:49838665-49838687 CAAACTCTCCCCAGGCAGAGAGG - Exonic
1149576510 17:57717114-57717136 CAACCTGTCCCCAATGAATGGGG - Intergenic
1151500458 17:74484906-74484928 CCACCTTCTCCCACTCAGTGAGG - Intergenic
1153269207 18:3303005-3303027 CAACCTTACCCCAGCCAGAATGG + Intergenic
1154935613 18:21052957-21052979 CAAGCTTTCCCAAGTCTGTAAGG + Intronic
1157681289 18:49609094-49609116 CAACCTATCCCCTGACTGTGGGG - Intergenic
1159556619 18:69952488-69952510 TATTCTTTCCCCACTCAGTGGGG - Intronic
1159851038 18:73527480-73527502 GAGCCTTTCCACAATCAGTGTGG - Intergenic
1160803177 19:979824-979846 CCACCTCTCCCCAGCCAGGGAGG + Intergenic
1163187996 19:15653105-15653127 TAACCTTTGCCCAGACAGTCAGG - Intronic
1163216895 19:15885749-15885771 TAACCTTTCCCCAGACAGTCAGG + Intronic
1164749634 19:30643112-30643134 CATCCTTTCCCAAGTTATTGGGG + Intronic
1165475563 19:36028401-36028423 CAACCTGTGCCCAGCCAGGGTGG + Intronic
1167744274 19:51341460-51341482 CAAGCTTTCCCCAGCAGGTGGGG - Exonic
925204728 2:1996365-1996387 CCACCTTTACCTAGTGAGTGAGG + Intronic
928158726 2:28901389-28901411 CAGCCCTTGACCAGTCAGTGGGG + Intronic
929349880 2:40937717-40937739 CCACCTTTCCCCAACCAGTGGGG - Intergenic
929999947 2:46854560-46854582 ATCCCTTTCCCCAGGCAGTGTGG + Intronic
932413146 2:71559009-71559031 CACCCTTTCTCCAGTCAGCCTGG + Intronic
932526208 2:72471821-72471843 CAACCTTTTCCCATTCAGGATGG + Intronic
932870984 2:75397578-75397600 CAACTTATCCCCATTCAGTATGG - Intergenic
934618650 2:95790986-95791008 CCTCCTTTCCCCAGTCAGCTCGG - Intergenic
934642243 2:96033571-96033593 CCTCCTTTCCCCAGTCAGCTCGG + Intronic
935132865 2:100274499-100274521 CAGTCTCTCCCCAGTCAGTGAGG - Exonic
936693182 2:114916860-114916882 CAACTTTTGCCCACTCAGTATGG - Intronic
937493882 2:122398077-122398099 CATCCTTTCCCAACTCATTGTGG - Intergenic
937545245 2:123009133-123009155 CATCCTTTTCCCATTCAGTACGG - Intergenic
938220266 2:129560319-129560341 CCAACTTGCCCCAGCCAGTGGGG + Intergenic
938769959 2:134493076-134493098 CAACATTACCCTAGTCATTGGGG - Intronic
940559261 2:155273430-155273452 CCACCTTTCCCCAGTCAGAGTGG - Intergenic
946166023 2:217864245-217864267 TACCCTCTCCCCATTCAGTGAGG - Intronic
947853536 2:233307650-233307672 CAACCTTCCCCAAGTCAGCTGGG + Intergenic
1172975658 20:38903899-38903921 CACCCACCCCCCAGTCAGTGGGG - Intronic
1174385711 20:50187573-50187595 CAGCCTTTCCCCAAGAAGTGGGG - Intergenic
1175032561 20:55970291-55970313 CAGCCTTAACACAGTCAGTGAGG + Intergenic
1175314144 20:58035052-58035074 CAACGTTTCCTCAGTCATTTTGG - Intergenic
1175976149 20:62711423-62711445 GAACCTCTCCCCAGTCCGCGTGG + Intronic
1177122167 21:17151297-17151319 CAGCATTTGCCCAGTCAGTATGG + Intergenic
1180682429 22:17637746-17637768 CATCCTTTCCTCAGTCACTCGGG + Intronic
1181096422 22:20508050-20508072 CTCCCTTTCCCTATTCAGTGTGG - Intronic
1183019210 22:35013814-35013836 CAACCATCTCCCAGTCAGTAGGG - Intergenic
1185074639 22:48676666-48676688 CACCCTCTCCCCAGCCAGTGTGG + Intronic
949920984 3:9000309-9000331 CAACCTTGCCCCAGCTTGTGAGG + Intronic
951438554 3:22694472-22694494 CCACCTTACCCCAGTCAGGATGG - Intergenic
952640339 3:35586813-35586835 CTACCTTTCCCCAGTTAGCAAGG + Intergenic
953731400 3:45452286-45452308 CAATTTTTTCCCATTCAGTGTGG + Intronic
954471742 3:50702941-50702963 CAACTTTTCCCCATTCCGTATGG + Intronic
956395288 3:68819459-68819481 CAACCTTTCACCATTGAGTTTGG + Intronic
958128063 3:89382904-89382926 CAATTTCTTCCCAGTCAGTGAGG + Intronic
958569944 3:95865943-95865965 CAACCATTCTGGAGTCAGTGTGG + Intergenic
958877294 3:99630904-99630926 CAACTTTTGCTCAGTCAGTCAGG + Intergenic
962812505 3:138971855-138971877 CAGCCTGACCCCAGACAGTGAGG - Intergenic
963600605 3:147375169-147375191 CCACCCATCCCCAGACAGTGTGG - Intergenic
963654096 3:148023856-148023878 AAATCTTTCCCCAGTGAGTGTGG + Intergenic
964929890 3:162004593-162004615 CAAATTTTGCCCATTCAGTGTGG + Intergenic
965831833 3:172799393-172799415 CAGCCTTTCCCAAGACAATGAGG + Intronic
966976047 3:185084421-185084443 AAACTTTACCCCAGTCATTGAGG - Intronic
967134857 3:186504605-186504627 CAATCATGCCCCAGTCAATGGGG + Intergenic
967700394 3:192585623-192585645 CAACCCCTCCTCAGTAAGTGGGG - Intronic
968126488 3:196164026-196164048 CAACCCTTCCCCAGTTTATGGGG - Intergenic
971128614 4:23781258-23781280 CTGCCTTTCTCCAGGCAGTGAGG + Intronic
971509962 4:27412626-27412648 AAGTCTCTCCCCAGTCAGTGAGG - Intergenic
971755920 4:30708377-30708399 CAACTTTTCCTCATTCAGTATGG + Intergenic
974697088 4:65390113-65390135 CAGTCTTTCCCCAGCCAGAGAGG - Intronic
975031233 4:69620026-69620048 CAGCTTTTCCCCATTCAGTATGG - Intronic
976576090 4:86673437-86673459 CAACCATTCCCCAATCACAGTGG - Intronic
977813948 4:101391731-101391753 CCACCTTACCCCAGCCAGAGTGG + Intergenic
978747715 4:112212700-112212722 CAATTTTTCCACAGACAGTGAGG + Intergenic
981482149 4:145249957-145249979 CTCTCTTTCTCCAGTCAGTGTGG + Intergenic
984973883 4:185213034-185213056 CACCCTTTCCCTTTTCAGTGAGG - Intronic
985468411 5:20308-20330 CATGCTTTCCCCACTCTGTGCGG + Intergenic
986673283 5:10162126-10162148 CTGCCTTTCCACAGCCAGTGGGG + Intergenic
989744556 5:44812535-44812557 CAGCCTTTTCTCAGTCACTGTGG + Intronic
992757091 5:79917733-79917755 CAGCTTTTGCCCATTCAGTGTGG - Intergenic
994297919 5:98113331-98113353 CAATTTTTCCACAGACAGTGTGG - Intergenic
994596604 5:101845749-101845771 AGAACTTTCCCCAGTCAGTCTGG - Intergenic
996521503 5:124431618-124431640 CAACTTTTCCCCATTCAGTATGG - Intergenic
996890814 5:128417449-128417471 CAGCTTTTCCCCATTCAGTATGG + Intronic
997604920 5:135167918-135167940 CAAACTGCCCCCAGACAGTGTGG - Intronic
998515334 5:142748801-142748823 AAGCCTTCCTCCAGTCAGTGAGG + Intergenic
1000382274 5:160639698-160639720 CAATTTTTCCACAGTCAGTGGGG + Intronic
1000499243 5:162028042-162028064 CAACCTTCCCCTATTCAGTATGG - Intergenic
1004645685 6:17558642-17558664 CAACTTTTCCACAGACAGGGTGG - Intergenic
1006589335 6:35142508-35142530 CAACCTTTGCCTTGTTAGTGTGG + Intronic
1006734533 6:36263693-36263715 CAGCCTTGCCCCCATCAGTGAGG - Intronic
1010150094 6:72721437-72721459 CACTCTTTCCCCAGTCTATGAGG - Intronic
1010496151 6:76535694-76535716 CAACTTTTCCCCATTCATTATGG + Intergenic
1012729588 6:102865062-102865084 CAAATTTTCCCCATTCAGTATGG - Intergenic
1018989608 6:168663470-168663492 CAACCTTTCCCCAGAAGGCGGGG - Intronic
1019382806 7:734199-734221 CAATTTTTCCCCATTCAGTGTGG + Intronic
1019771078 7:2883829-2883851 CAACCTGTCCTAAGTCACTGAGG - Intergenic
1023933980 7:44725985-44726007 CAACCTTTCTCCAGCCAGCAAGG - Intergenic
1024843482 7:53615006-53615028 CAATATATCCCCATTCAGTGCGG + Intergenic
1027255143 7:76426250-76426272 CTCCCTTTCCCTAGCCAGTGGGG + Intronic
1028405440 7:90468974-90468996 CAATCTTGCCCCAGTATGTGTGG - Intronic
1029945260 7:104526234-104526256 CAACTTTTCCCCAATCCATGTGG - Intronic
1031171458 7:118297212-118297234 CAGTCTTTCCCCATTCAATGTGG - Intergenic
1034403406 7:150883041-150883063 CAACTTTTCCCCATTCAGTATGG - Intergenic
1034826615 7:154270903-154270925 CAACACTGCCCCAGTCCGTGTGG + Intronic
1034924272 7:155108398-155108420 CAACCTCACTCCAGTCAGTGTGG - Intergenic
1035933184 8:3807082-3807104 TAACCTTCCCCCAGTGCGTGGGG - Intronic
1037637868 8:20716580-20716602 AAACCTTTCCCTACTCACTGTGG + Intergenic
1037805729 8:22057118-22057140 CTACCTCTTCCCAGACAGTGTGG - Intronic
1041705725 8:60844369-60844391 GAACCTTTCACCAGTGACTGTGG + Intronic
1043720795 8:83545271-83545293 CAACCTTTCCCAAATCGGTTAGG + Intergenic
1046102727 8:109633353-109633375 CAACTTTTCCCTGCTCAGTGTGG - Intronic
1046284386 8:112075528-112075550 CCACCTTTCCCCAGCCAGAATGG - Intergenic
1049155797 8:141065980-141066002 CTATCTCTCCCCAGCCAGTGGGG - Intergenic
1054802798 9:69368294-69368316 CAGCTTTTCCTCATTCAGTGTGG + Intronic
1055002012 9:71461942-71461964 TAACCTTTCCCCAAAGAGTGAGG - Intergenic
1055483831 9:76736945-76736967 CCACCTTTCCCGGGTCAGTGTGG - Intronic
1056087861 9:83171022-83171044 CAATTTTTCCCCATTCAGTGTGG + Intergenic
1057000959 9:91508932-91508954 CCACTATTCCCCAGCCAGTGAGG - Intergenic
1057463622 9:95291116-95291138 TAACTTTTCCCCAGTCGGTATGG - Intronic
1058486229 9:105445805-105445827 CAACCTTTCCCAACTCCGTGAGG - Intergenic
1060178874 9:121517951-121517973 ACACCTTTCCCCACTCAGAGAGG - Intergenic
1060790007 9:126479572-126479594 CAACACTTCCCCAGAAAGTGGGG - Intronic
1061086221 9:128400364-128400386 CCACCTGTCCCCACTCAGAGGGG + Intergenic
1203786708 EBV:132327-132349 CACCCTCTCCCCAGACAGTCCGG + Intergenic
1186627947 X:11315231-11315253 CAACTTTTCCACAGACAGTGCGG + Intronic
1188735655 X:33711760-33711782 CAACCTTACCCCAGCCAGAATGG + Intergenic
1190111219 X:47590320-47590342 CAACCTGTCCCCACCCTGTGTGG + Intronic
1192530517 X:71879099-71879121 CAGCTTTTCCCCATTCAGTATGG - Intergenic
1192741976 X:73902334-73902356 CATCTTTTCCCCTTTCAGTGTGG + Intergenic
1192863487 X:75105072-75105094 CAAGTTTTCCCCATTCAGTGTGG - Intronic
1193310342 X:80000712-80000734 CAACCTTTTCGAAGTCAGTGTGG - Intergenic
1193857092 X:86616456-86616478 CAACCTTACACCAGTCAGAATGG - Intronic
1195448644 X:104983763-104983785 ATACTTTTCCCCAGTTAGTGAGG + Intronic
1197142885 X:123136179-123136201 CCACCTTACCCCAGTCATTATGG + Intergenic
1197148675 X:123195961-123195983 TAACCTTCCCCCAGGCAATGCGG + Intronic
1197449525 X:126594455-126594477 CAACCTGTCCTGAGTCAGAGGGG - Intergenic
1197646003 X:129017227-129017249 CCACCTTACCCCAGTCAGAATGG - Intergenic
1198522205 X:137464491-137464513 CAACCTCTCCCCAGCCCCTGAGG - Intergenic
1200169931 X:154065151-154065173 CTACCTTTTCCCAGTCTCTGAGG + Intronic
1200243939 X:154512813-154512835 CAACTCTTCACCAGTGAGTGTGG - Exonic
1201384641 Y:13425437-13425459 GATTCTTTCACCAGTCAGTGTGG - Intronic