ID: 1073793287

View in Genome Browser
Species Human (GRCh38)
Location 10:106961418-106961440
Sequence TGTATTAACTAAGTAGTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073793285_1073793287 23 Left 1073793285 10:106961372-106961394 CCTTCCTGGTAATCTGGTTCTAC 0: 1
1: 0
2: 2
3: 16
4: 129
Right 1073793287 10:106961418-106961440 TGTATTAACTAAGTAGTAGATGG No data
1073793286_1073793287 19 Left 1073793286 10:106961376-106961398 CCTGGTAATCTGGTTCTACATAC 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1073793287 10:106961418-106961440 TGTATTAACTAAGTAGTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073793287 Original CRISPR TGTATTAACTAAGTAGTAGA TGG Intronic
No off target data available for this crispr