ID: 1073793857

View in Genome Browser
Species Human (GRCh38)
Location 10:106966704-106966726
Sequence GTGGAGAAACAGAGTCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 591
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 539}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073793857_1073793863 30 Left 1073793857 10:106966704-106966726 CCCTCCTGACTCTGTTTCTCCAC 0: 1
1: 0
2: 5
3: 46
4: 539
Right 1073793863 10:106966757-106966779 AAAATCTGCACCTGAGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073793857 Original CRISPR GTGGAGAAACAGAGTCAGGA GGG (reversed) Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900502890 1:3015295-3015317 CTGGAGGAACACAGGCAGGAGGG - Intergenic
900546440 1:3231825-3231847 GTGGAGAAGCTGAACCAGGAAGG - Intronic
900792348 1:4688910-4688932 GTGGAGAAACTGAGGCAGGGAGG + Intronic
902141783 1:14362898-14362920 ATAGAGAAACTGAGGCAGGAAGG + Intergenic
902231704 1:15031494-15031516 GTGGGGAAGGAGAGTCTGGAGGG + Intronic
902373318 1:16018396-16018418 GAGGAGAACCAGAGTCTGGAGGG - Exonic
902540341 1:17149838-17149860 GTGGAGTAACAGGCTCAGGGAGG + Intergenic
902609707 1:17589796-17589818 GTGGAGAAACTCAGTCTGGTGGG + Intronic
902828299 1:18992700-18992722 GTGGAGAAACAGGTTGAGGCTGG - Intergenic
903066030 1:20700015-20700037 GTGCAGAAACTCAGTCTGGAGGG + Intronic
903549754 1:24149740-24149762 CTGGAGAAACAGACTCAGAGTGG + Intergenic
903787692 1:25872297-25872319 TTGGAGAAACAGGGCCAAGAGGG - Intergenic
904709474 1:32417989-32418011 TTGGAGGAACAGGGCCAGGAAGG - Intergenic
904891909 1:33785641-33785663 GAGAAGAAACAGAGGCAGGGTGG + Intronic
904964548 1:34361298-34361320 ATGGGGAAAGAGAGCCAGGATGG + Intergenic
905110884 1:35593620-35593642 CTGGAGAAACCTAGCCAGGACGG + Intronic
905295536 1:36952055-36952077 ATGCAGAAACAGGGTCAGCAAGG + Intronic
905352795 1:37359153-37359175 GAGGAGAAACAGAGAGAGGTTGG + Intergenic
905785186 1:40749889-40749911 GTGGAGAAACACAATCACCATGG - Intronic
906679033 1:47712464-47712486 ATGGAGAAACCAAGGCAGGAAGG - Intergenic
906848221 1:49218044-49218066 GAGCAGAAACAGAATCAGTAGGG - Intronic
907277523 1:53325529-53325551 GTGAGGAAACTGAGGCAGGAGGG + Intronic
907399708 1:54217375-54217397 CTGAAGACACAGAGTCAGGAGGG - Intronic
907611715 1:55877761-55877783 GTGGAGAGGCAGAGTCAAAAAGG + Intergenic
908582839 1:65535470-65535492 GTGGGGACACTGAGGCAGGAGGG - Intronic
910773287 1:90851198-90851220 GTGGAGAGACCCAGTCTGGAGGG - Intergenic
911052693 1:93684595-93684617 GGGAGGAAACAGACTCAGGAAGG + Intronic
911185775 1:94903369-94903391 GAGCAGAAACAGATTCTGGAGGG + Intronic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
911814331 1:102325796-102325818 GAGGTGATACAGAGTCAGAATGG - Intergenic
912448045 1:109752193-109752215 CCTAAGAAACAGAGTCAGGATGG + Exonic
913539462 1:119804975-119804997 GTGAGGAAACAGGCTCAGGATGG + Intronic
914386952 1:147178947-147178969 CTGGAGAAACAGGGTAATGATGG + Intronic
915477081 1:156159479-156159501 GTGGAGAGACAGAGGCACGAGGG + Intronic
915713043 1:157919613-157919635 GTGGGGAAGCAGAAGCAGGAGGG - Intergenic
915899178 1:159834197-159834219 GTGGAGAAAGGGAGTCAGCAAGG + Intronic
916051090 1:161037770-161037792 TTGGAGAAAGAGAGTTAGGCAGG - Exonic
916447012 1:164881645-164881667 GTGGGGAAAAAGAGGAAGGAAGG + Intronic
916512114 1:165481801-165481823 GGAGAGAAAGAGAGACAGGAGGG + Intergenic
917790946 1:178498347-178498369 TTTGAGAAACCGAGGCAGGAGGG + Intergenic
918609036 1:186465425-186465447 GTGGGGCAAGAGAGACAGGAGGG + Intergenic
918778169 1:188665303-188665325 GTGGAGAACCAGAGACTGCAAGG - Intergenic
918778581 1:188668338-188668360 GTGGAGAACCAGAGACTGCAAGG - Intergenic
919178221 1:194047272-194047294 GTGGGAAAACAGAAACAGGAGGG + Intergenic
919774501 1:201185320-201185342 GTGCAGAAACAGAGTCCAAAAGG - Intergenic
919836138 1:201574781-201574803 GAGGATAAACAGAGGCAGGGAGG - Intergenic
920087174 1:203426112-203426134 GTGAAGAAACAGATTCAGAGAGG - Intergenic
920919135 1:210283741-210283763 TTAGAGAAACAGAGTTAGGCTGG - Intergenic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921798933 1:219379931-219379953 GTGGTGAAGAAGAGGCAGGAAGG + Intergenic
921953261 1:220955721-220955743 GTGGTGTAACAGTGTTAGGAAGG + Intergenic
922085513 1:222343253-222343275 CTGGGGAAAGGGAGTCAGGAAGG + Intergenic
922490396 1:226011969-226011991 GTGTGGAAACAGACTCAGAAAGG + Intergenic
923341039 1:233007381-233007403 GTGGAGAAAGAGAGTAAGATGGG + Intronic
923457727 1:234179107-234179129 GTCAAGAAACAGAGTCGTGAAGG - Intronic
924440782 1:244083456-244083478 GTGGAGCTCCAGATTCAGGAAGG + Intergenic
1063017777 10:2095704-2095726 GTGGAGGGACAGAGAGAGGATGG + Intergenic
1063842650 10:10089488-10089510 CTGCAGGAACAGAGCCAGGATGG - Intergenic
1064886028 10:20113577-20113599 GTGTAGAAAATGAGTAAGGAGGG - Intronic
1064891085 10:20174594-20174616 GTGGAAAAAAAGACACAGGAAGG + Intronic
1065362125 10:24898589-24898611 GAGGAGAAGCAGAGACAAGAAGG - Intronic
1065455817 10:25905559-25905581 GTGCAAAACCACAGTCAGGAGGG - Intergenic
1066653157 10:37678719-37678741 CGTGAGAAACAGAGACAGGAAGG - Intergenic
1067037511 10:42931261-42931283 CATGAGAAACAGAGACAGGAAGG - Intergenic
1067349391 10:45462329-45462351 GGGGGGAAACAGAGTTAGGATGG + Intronic
1067509322 10:46882336-46882358 TTGGAGCAACAGATTCAGCATGG + Intergenic
1067652931 10:48169519-48169541 TTGGAGCAACAGATTCAGCATGG - Intronic
1068496761 10:57792532-57792554 TTGGAGGAACAGGGCCAGGAAGG - Intergenic
1069652683 10:70061275-70061297 GTGGATGAATAGATTCAGGAAGG + Intronic
1070322324 10:75363459-75363481 GTGGATAAACAGAGACAGAAGGG - Intergenic
1070635683 10:78125376-78125398 CAGTAGAAACAGAGTGAGGAAGG + Intergenic
1070828818 10:79406441-79406463 GTGAAGAAGCAGGGTCAGCAGGG - Intronic
1071200029 10:83211574-83211596 CTGCAGAATCAGAGTCAGGGTGG + Intergenic
1072374961 10:94804701-94804723 GTGGACAAACAGCCTCATGATGG - Intronic
1072742152 10:97915862-97915884 GTGGAGGAACAGAGGGAGGCTGG - Intronic
1073043622 10:100623537-100623559 ATGGAGAAAGACAGGCAGGAAGG + Intergenic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1073930474 10:108568265-108568287 GTGGGGCAACAGAGTGAAGAAGG - Intergenic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074507012 10:114080000-114080022 GTGCAGAAACAGGGTCAGTTTGG - Intergenic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1074541635 10:114370040-114370062 ATGGGGAAACAGAGTCAGGGAGG - Intronic
1074610501 10:115016813-115016835 GAGGAGAAGGAGAGTCTGGAGGG + Intergenic
1075175973 10:120161322-120161344 GTGGAGAATCACTGTCATGAAGG + Intergenic
1075678333 10:124313409-124313431 GAGGAGGAAAAGAGGCAGGAAGG + Intergenic
1075996236 10:126878477-126878499 GTGCAGACAGAGAGCCAGGATGG - Intergenic
1076079952 10:127570320-127570342 GTGGAGGATCAGCCTCAGGAGGG + Intergenic
1076120412 10:127932579-127932601 CTGCAGCAACAGAGACAGGAGGG + Intronic
1076219610 10:128722677-128722699 GAGGGGAAACTGAGTCAGGCTGG + Intergenic
1076474943 10:130745387-130745409 GGGGAGAAGGAGGGTCAGGAGGG - Intergenic
1076602735 10:131669513-131669535 GTGGAGAAAGAGAGAGAGGGGGG + Intergenic
1077444775 11:2585836-2585858 CTGGAGCAACAGGGGCAGGAAGG + Intronic
1078608189 11:12796076-12796098 GTGCAGAAACTGGGCCAGGAGGG + Intronic
1078745970 11:14114603-14114625 GTGAAGAAATAGAGGCTGGATGG - Intronic
1080463646 11:32477126-32477148 TTGAAGAAGCAGAGTCAGGCCGG + Intergenic
1080957087 11:37110766-37110788 GTGGAGAAATAATTTCAGGAGGG + Intergenic
1081577479 11:44328254-44328276 GTGTAGAAAAAAAGACAGGAGGG - Intergenic
1081612862 11:44573527-44573549 GTGGAGTAACTGAGGCAGGGAGG + Intronic
1082243996 11:49899382-49899404 GAGGAGAAACAGAGTCGTCAAGG - Intergenic
1083047427 11:59749369-59749391 GAGGAGAACCACAGTCAGGTGGG - Intronic
1083477512 11:62923625-62923647 ATGGGGAAACTGAGGCAGGAGGG + Intergenic
1083882496 11:65555445-65555467 GTGGAGACACTGAGCTAGGAAGG - Intronic
1084079962 11:66815901-66815923 ATAGAGAAACAGGTTCAGGAGGG + Intronic
1084392406 11:68886448-68886470 TTGGAGAAACAGACTCAAAAAGG - Intergenic
1084687818 11:70707509-70707531 GTGGACAGACAGAGGCAGGAAGG + Intronic
1084960976 11:72716489-72716511 GTGGAGGAACAGCATCTGGACGG + Intronic
1084969711 11:72764500-72764522 GTGAAGAAACTGAGGCAGGCCGG + Intronic
1085021807 11:73214729-73214751 GTAGAGAAACAGGTTCAGAAAGG - Intergenic
1085564542 11:77501342-77501364 GTGGAGAGACTGAGTCCGGGTGG - Intergenic
1085848806 11:80096767-80096789 GTGGAGAAACACGATCATGATGG + Intergenic
1086527206 11:87741592-87741614 CTGTAGAAACAGGGTCAAGAGGG - Intergenic
1090750048 11:129738669-129738691 CTGTAGACAAAGAGTCAGGAAGG + Intergenic
1091144040 11:133261715-133261737 GTGGAGAAAGAGAGACGGGGAGG + Intronic
1091332736 11:134743445-134743467 GAGGAGAAACACAGTCAGGAGGG - Intergenic
1091544311 12:1490896-1490918 GCCGAGGAACAGAGTGAGGAAGG - Exonic
1092126847 12:6080592-6080614 GAGAAGAAACAGAGTCACCACGG + Intronic
1092233323 12:6790044-6790066 GAGGAGAAAAAGAGTGAAGAAGG + Intronic
1092234198 12:6795905-6795927 GTGGAGAGCCACAGACAGGATGG + Intronic
1092623511 12:10300515-10300537 GTGAATAAACAAAGTCTGGATGG - Intergenic
1092752631 12:11733027-11733049 ATGGAGAAACAGAGTCTGAGTGG - Intronic
1093029738 12:14277244-14277266 GTGGAGAAACAGAGATAGAAGGG - Intergenic
1093554436 12:20453751-20453773 TAAGAGAAACAGAGCCAGGAAGG - Intronic
1093791216 12:23252578-23252600 GTGAGGAAACTGAGTCATGAGGG + Intergenic
1093870074 12:24280318-24280340 GTTAAGAAACACAGTCAGGGAGG + Intergenic
1094157143 12:27349078-27349100 GAGGAGAATCAGAGTCATGGGGG + Intronic
1095854538 12:46845440-46845462 GGGGAAAAAGAGAGTGAGGAGGG + Intergenic
1096278405 12:50230492-50230514 GGGGAAAAACAGAGGCAAGAGGG + Intronic
1097668240 12:62506000-62506022 GTGGAGAAGTAGAGTTGGGATGG + Intronic
1098248449 12:68544305-68544327 GTTGGGAGACAGAGTCTGGATGG - Intergenic
1098384297 12:69902424-69902446 ATGGAGAAACAGTGGTAGGAGGG - Intronic
1098961307 12:76742369-76742391 GTGGCAAATCAGAGTTAGGAGGG + Intergenic
1099051257 12:77783983-77784005 AGGGAGAAGCAGAGTCATGATGG - Intergenic
1099644232 12:85330426-85330448 GTGGAGAAAGGGAGGGAGGAAGG - Intergenic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100130126 12:91482195-91482217 GTGGAGAAACAAAGTCTGAGAGG + Intergenic
1100284780 12:93154882-93154904 GTGGAGGGACTGAGTCACGAAGG - Intergenic
1100657167 12:96659592-96659614 ATGGAGAAATAGACTCATGAAGG + Intronic
1101625810 12:106440174-106440196 ATAGAGAAAAAGGGTCAGGACGG - Intronic
1104793043 12:131495878-131495900 GAGAAGAAATAGACTCAGGAGGG - Intergenic
1104915031 12:132260167-132260189 ATGGAGAAACAGACACAGGGAGG + Intronic
1104937246 12:132372812-132372834 GGCGAGAAAGAGAGACAGGAAGG + Intergenic
1105343283 13:19548573-19548595 GTGGCGAAAGAAGGTCAGGATGG - Intergenic
1105537027 13:21275523-21275545 GTGGCGAAAGAAGGTCAGGATGG + Intergenic
1105567734 13:21567464-21567486 GTGGCAGAAGAGAGTCAGGAGGG + Intronic
1105603100 13:21904459-21904481 ATGGAGAAACAGAGTCCTGAAGG - Intergenic
1106322803 13:28658396-28658418 GTGAAGAAACCGAGACATGAAGG - Intergenic
1106689233 13:32096030-32096052 GTGAAGAAATAAAGACAGGAAGG - Intronic
1107646554 13:42500007-42500029 GTGGAGACAGAGAGGCAAGACGG - Intergenic
1108789359 13:53948984-53949006 GTGGGGAAAAAGAGTAATGACGG - Intergenic
1109204910 13:59471370-59471392 GTGGAAAAACAAAGTCAAAAGGG + Intergenic
1109267348 13:60216766-60216788 GGAGAGAGACAGAGTTAGGAAGG + Intergenic
1109897426 13:68711857-68711879 GAGGAGATAATGAGTCAGGAGGG - Intergenic
1110496896 13:76178469-76178491 GTGGAGAGAAAGAGTGAAGACGG + Intergenic
1110522563 13:76498106-76498128 GTGCAGAAATAGAGGAAGGAAGG + Intergenic
1110963452 13:81659944-81659966 GAGGAGAAACAGGGGAAGGATGG + Intergenic
1112219196 13:97470843-97470865 GTGGGGATACAGAGGCAGGTTGG + Intergenic
1112503616 13:99959984-99960006 GCGGACAAAAAGAGTCAGGGGGG - Intergenic
1112696873 13:101959468-101959490 GTTGTGAAACAAAGTCAGGGAGG - Intronic
1113049099 13:106188652-106188674 GGTGAGAGACACAGTCAGGAAGG - Intergenic
1114370340 14:22079753-22079775 CTGCAGAAACAGAGTCACTAGGG - Intergenic
1117025272 14:51613205-51613227 GTGGAGAAAGAGAGGCAAGTTGG + Intronic
1117119678 14:52553538-52553560 GTGGAGAACTGGAGACAGGAGGG - Exonic
1118489856 14:66248430-66248452 GTGGAGAAAAAGGGAGAGGAAGG + Intergenic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1121059715 14:90895534-90895556 GTGGAGAAGAAGAGAAAGGATGG - Intronic
1121467643 14:94126352-94126374 GGAGAGCAACAGAGGCAGGAGGG - Intergenic
1121584096 14:95051112-95051134 GTGCAGAGACAGAGCCAGGCAGG - Intergenic
1121630621 14:95419252-95419274 GTTGAGTAACAGAGTCTGGGTGG - Intronic
1121852029 14:97230117-97230139 GTGGAGACACAGCATCTGGAAGG - Intergenic
1122043627 14:99008159-99008181 GGGGAGAGGCAGAGGCAGGAGGG - Intergenic
1122236270 14:100332304-100332326 GTGGGGAAGCAGGGACAGGAAGG - Intergenic
1122296115 14:100706572-100706594 GTGGAGACACAGTGTCAGTAGGG + Intergenic
1122634001 14:103121898-103121920 GTGGGGGAACAGAGTCTGGCAGG + Intergenic
1122666006 14:103330148-103330170 GTGAGGAAAGAGACTCAGGAAGG - Intergenic
1122862147 14:104587503-104587525 GTGAAGAGACGGGGTCAGGAGGG + Intronic
1122960861 14:105093161-105093183 GTGGAGAAAGAGAGTATGGCGGG + Intergenic
1125552709 15:40559087-40559109 GTTGAGAAAGAGAGAGAGGAAGG - Intronic
1126302542 15:47214346-47214368 GTGGAAAAGCACAGTCTGGAAGG + Intronic
1126374812 15:47986810-47986832 GTGGTGAAACAAAGTGAGGCAGG + Intergenic
1126813007 15:52427433-52427455 GGGAAGAAACACAGTAAGGAGGG + Intronic
1126838997 15:52697381-52697403 GTGGAGAAAGAGAGGCAAGCGGG - Intronic
1126922022 15:53537540-53537562 ATGAAGAAACAGAGACAGAAAGG - Intronic
1127276007 15:57444753-57444775 GTGGGAACACAGAGCCAGGATGG + Intronic
1127488530 15:59440757-59440779 GTGGAGAAACAGAGTCACAGAGG - Intronic
1127903901 15:63361729-63361751 GTGGGAGAACACAGTCAGGAGGG + Intronic
1128301378 15:66568140-66568162 GTGGAGGCACAGAGTGGGGAAGG + Intergenic
1128436275 15:67652439-67652461 GTGGAGCAAGAGAGAGAGGAGGG + Intronic
1128709532 15:69861317-69861339 GTGGGGAAACTGAGGCTGGAAGG + Intergenic
1128760639 15:70214084-70214106 CTGGAGAAAGGGAGTCGGGAGGG - Intergenic
1129231359 15:74198920-74198942 GTGGAGAAAGGGAGTGAGGCAGG + Intronic
1129831927 15:78676284-78676306 GTGGAGGAAGAGAAACAGGAGGG + Intronic
1129885838 15:79036420-79036442 GTGGAGAAACAGAGGCGGGAGGG - Intronic
1130112479 15:80977175-80977197 GAGGAGAAATAGAGTAAGGCAGG - Exonic
1130972026 15:88741196-88741218 GTGGAGAAACTGTGGAAGGATGG + Intergenic
1131610450 15:93955695-93955717 ATGGTGAAACTGAGTCAGGCAGG - Intergenic
1132714005 16:1281734-1281756 GTGGGGAAACTGAGGCTGGAGGG - Intergenic
1133002028 16:2856610-2856632 GAGGAGAGAGAGAGCCAGGAAGG - Intronic
1133946079 16:10349703-10349725 ATGGAGACACATAGTCAAGAAGG + Intronic
1133947149 16:10358088-10358110 GATGAGAGACAGAGTCTGGATGG + Intronic
1134316831 16:13126646-13126668 GTGGAGAGAGAGACTGAGGAAGG + Intronic
1134686941 16:16165638-16165660 GAGGAGAAACAGTGGCAGGATGG + Exonic
1137534252 16:49305705-49305727 GGGGAGAAACAGGGAGAGGAAGG - Intergenic
1137573627 16:49583390-49583412 GTGGGGAAAAAAAGTCATGATGG + Intronic
1137845000 16:51678370-51678392 ATGGATAATCAGAGGCAGGAGGG - Intergenic
1138128426 16:54457442-54457464 GAGGAGAAAAAGAGGAAGGAAGG - Intergenic
1138318600 16:56091478-56091500 GAGGTGAAACAGGGTGAGGAGGG + Intergenic
1138756340 16:59490654-59490676 CTAAAGACACAGAGTCAGGAAGG + Intergenic
1139197092 16:64932203-64932225 GTGCAGAAACAAAGTTAGAAAGG - Intergenic
1139230795 16:65280620-65280642 GAGGAAAATCAGAGTTAGGAAGG + Intergenic
1139642069 16:68298926-68298948 GTGGAGAAGAATGGTCAGGAAGG - Exonic
1141263445 16:82474512-82474534 CTGGAGAAACAAAATCTGGAAGG + Intergenic
1141346195 16:83248276-83248298 AAGGAGAAACAGAGGCAGGGGGG + Intronic
1141601002 16:85126330-85126352 GCCGACGAACAGAGTCAGGAAGG - Intergenic
1142150290 16:88509658-88509680 GTGGAGAAACAGGCCCAGGGAGG + Intronic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1143013299 17:3878278-3878300 GTGGATGAACAGAGGCACGAGGG - Intronic
1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG + Intergenic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144190748 17:12843240-12843262 GGGGAGAAACAGAGGGAGGCAGG - Intronic
1146373478 17:32279762-32279784 ATGGAGAAACAGAGGCAGGGTGG + Intronic
1146913709 17:36664807-36664829 ATGGAGAAACTGAGTCTGGGAGG + Intergenic
1146928094 17:36758687-36758709 GGGGAGAATCACAGTCTGGAGGG + Intergenic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1148547351 17:48528501-48528523 ATGGAGAAACAGAAGCAGGCAGG + Intergenic
1150842357 17:68620646-68620668 GTGGAGAAAAAGAGATAGAAAGG + Intergenic
1151115547 17:71730879-71730901 GTAAAGAAACTGAGTCAGAAAGG + Intergenic
1151985957 17:77543918-77543940 TTGTTGAAACAGAGTCAGGGTGG + Intergenic
1152471164 17:80490782-80490804 GTGGAGAAACCAAGACTGGAGGG - Intergenic
1152675376 17:81637411-81637433 GTAGAGAAACAATTTCAGGAAGG + Intronic
1152741930 17:82022265-82022287 GTGGAGAAACTGAGGCACGGGGG - Intronic
1153187493 18:2501419-2501441 ATGAAGAAACAGATTCAGGTAGG - Intergenic
1153273273 18:3344047-3344069 ATGAAGAAACAGATTCAAGAAGG - Intergenic
1153428600 18:4991599-4991621 GTGGAGAAAGAGAGAGAGGGAGG + Intergenic
1154072554 18:11165882-11165904 GCAGGGAAACAGAGGCAGGAAGG + Intergenic
1155923565 18:31630013-31630035 GTGGAGAAGGAGAAGCAGGAAGG + Intronic
1155946445 18:31857652-31857674 GTAGAAGAACAGTGTCAGGAAGG + Exonic
1156980837 18:43286458-43286480 GTGGAGCTACAGAGGCAGGCAGG - Intergenic
1157116038 18:44863736-44863758 GTAGAGAGACAGAGTGAAGATGG - Intronic
1157866776 18:51194873-51194895 GTGGAGGAACAATGTGAGGAGGG - Intronic
1158016311 18:52788731-52788753 TTGGAGGAACAGGGCCAGGAAGG + Intronic
1158343432 18:56490420-56490442 GTGGAGAATGAAAGTTAGGAAGG + Intergenic
1158621743 18:59038617-59038639 GAGGAGAAGCAGGGTCTGGAGGG + Intergenic
1159005171 18:63004663-63004685 GTGGAGACCCAGAGCCAGGAGGG + Intergenic
1159067695 18:63588338-63588360 GTGGAGAGGCAGAGACAGGCAGG + Intronic
1160119111 18:76111549-76111571 GTGGAGAGACTGACTTAGGATGG + Intergenic
1160662161 19:306231-306253 GTGGAGAGACAGAGCCAAGCAGG + Exonic
1160762340 19:791870-791892 GTGGGGAAAGAGGGTCAGGCTGG + Intergenic
1161096428 19:2394528-2394550 GAGTAGAAACAGAGTGAGGTTGG + Intronic
1161245862 19:3251477-3251499 GTGGAGAAAGAAAGGCGGGAAGG + Intronic
1161254319 19:3298538-3298560 GTGGACCCACAGAGACAGGAAGG - Intergenic
1161770698 19:6229187-6229209 GTGGAAAAGCGGAGCCAGGAGGG + Intronic
1162017767 19:7854804-7854826 GTGGGGAAACTGAGTCAGAGTGG - Intronic
1162071898 19:8157912-8157934 GAGGAGAAAGAGAGGAAGGAAGG + Intronic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1162996649 19:14340046-14340068 GGGGAGAAGGAGAGTGAGGAAGG - Intergenic
1164918321 19:32069889-32069911 GTGGAGAAAAAGATTGGGGAGGG - Intergenic
1165094612 19:33403334-33403356 GTCCAGAACCAGAGCCAGGAGGG + Intronic
1165426802 19:35750357-35750379 GAGGAGAGACAGAGTGAGGGTGG - Intronic
1165474613 19:36023354-36023376 ATGGAGACCCAGAGGCAGGAAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166536766 19:43579564-43579586 GAGGAGAAGCAGAGACAGGGAGG + Intronic
1166738592 19:45100752-45100774 GAGGAGAAACAGAAACAGGTGGG + Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167642136 19:50687775-50687797 GGGGAGAAACTGAGGCAGGGAGG - Intronic
1168292643 19:55364053-55364075 ATGGAGAAACAGGTTCAGTAAGG - Intergenic
1168372704 19:55849572-55849594 GGGGAGAAAGAGAGCCAGGGAGG + Intronic
924986152 2:271825-271847 GTGGGGAAACAGGGTTAGGTTGG - Intronic
925093315 2:1172824-1172846 GTGGAGGGACAGCATCAGGAAGG - Intronic
925100258 2:1238285-1238307 GTGGAGAGAAAGAGAGAGGAAGG - Intronic
926046718 2:9715399-9715421 TTGGAGAAACAGACTCAACAAGG - Intergenic
926111192 2:10184820-10184842 ATGGGGAAACTGAGTCAGAAAGG + Intronic
926230820 2:11002633-11002655 GTGCAGAAAGGGAGTGAGGAAGG + Intergenic
926451163 2:13005935-13005957 GAGGAGGAACAGAGGCAGGAAGG - Intergenic
926847300 2:17155926-17155948 GAGGGGAAACAGAGTCAACATGG - Intergenic
927152159 2:20202485-20202507 TTGGAGAAACCGAGTCAGAATGG + Exonic
927856171 2:26529233-26529255 GTGGAGAGACCGTGTCAGGGAGG + Intronic
928207469 2:29296395-29296417 GGGGAGAAACAGAATCAAAACGG - Intronic
928312319 2:30221144-30221166 CTGGAAGAACAGAGTCAAGAGGG - Intergenic
928435396 2:31251532-31251554 ATGAAGCAACTGAGTCAGGAGGG + Intronic
929624276 2:43390300-43390322 GTGGATAAACAAGGCCAGGAAGG - Intronic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
931925838 2:67071538-67071560 GTGGTGAAAGAGAGTGAGGAAGG - Intergenic
932769746 2:74493939-74493961 GTGGAGAAACAGAGTGGCCAAGG - Exonic
934055242 2:88246070-88246092 GTGGAGAAACAGAAACATGGAGG - Intergenic
934064970 2:88331928-88331950 GTTGAGAAAAAGAGTCAAGGAGG - Intergenic
934616094 2:95772192-95772214 GAAGAGAAGCAGAGGCAGGAGGG - Intergenic
934644802 2:96052368-96052390 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
934692405 2:96371866-96371888 GTGGAGGAACAGACTCCAGACGG - Intronic
934838213 2:97608457-97608479 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
935186858 2:100742553-100742575 CTGTAGAAACTCAGTCAGGATGG - Intergenic
936114440 2:109690817-109690839 GGGAAAAAACAAAGTCAGGAAGG - Intergenic
936789245 2:116131272-116131294 ATCGAGAAACAGAGACAGTATGG + Intergenic
937075748 2:119105143-119105165 GTGGAGAAGAACAATCAGGAGGG - Intergenic
937327753 2:121001834-121001856 GTGGAGAAATGGAGTCATGGTGG + Intergenic
937637055 2:124167936-124167958 GAGAAGAAAGAGAGCCAGGAAGG + Intronic
937642698 2:124231362-124231384 ATGGAGAAACAGAGTCAGAGAGG + Intronic
938468736 2:131541303-131541325 GGGGAGAAACAGAGAAACGAAGG + Intergenic
940986271 2:160055285-160055307 TGGGAGAAACGGAGTCAAGAAGG + Intronic
942310340 2:174650572-174650594 ATGGAGAAGAACAGTCAGGATGG - Intronic
942608328 2:177714979-177715001 GTGGGGAACCAGACACAGGAGGG - Intronic
942922240 2:181389577-181389599 CTGAAGAAACAGATGCAGGAAGG - Intergenic
943731300 2:191306114-191306136 GTGGAGAAACAACGTGGGGAAGG + Intronic
944855545 2:203763805-203763827 GTGGAGAAAATGAGCCATGAAGG + Intergenic
944893966 2:204145307-204145329 TTGGAGACACTGGGTCAGGAAGG - Intergenic
946412015 2:219520163-219520185 GTGGAGAAGGAGGGTCGGGAGGG - Intronic
946996660 2:225400321-225400343 GAGGAGAAAGAGAAGCAGGAAGG + Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947055185 2:226091979-226092001 GTGGAGCAACACACTCAGGCTGG - Intergenic
947384044 2:229572508-229572530 GTGGAGAATCCAAGTAAGGAAGG + Intronic
947760414 2:232599956-232599978 GTGAAGAAGCAGAGCCCGGAAGG + Intergenic
947773311 2:232687969-232687991 GTGGACAGGCAGAGTCAGCAAGG - Intergenic
948496292 2:238352004-238352026 GGGAAGAAACAAAGGCAGGAGGG + Intronic
1169627526 20:7588957-7588979 GTGGATAAAGAAAGACAGGAGGG + Intergenic
1170075195 20:12411209-12411231 TTCTAGAAACAGAGTCAGGGAGG - Intergenic
1170455213 20:16526450-16526472 GTGGAAATACAGAGTCTGGCTGG - Intronic
1170828748 20:19821111-19821133 GTGGAGAAACAGAGTTAAAGCGG - Intergenic
1172057118 20:32161922-32161944 GTGGGGTCACAGAGTTAGGAGGG - Intronic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172546517 20:35765994-35766016 GTGGAGAGCCAGAGGAAGGAAGG - Intergenic
1172563126 20:35906798-35906820 GTGGAGAAATAGTGTTGGGAAGG + Intronic
1172604090 20:36202946-36202968 GGGGAGAAACAGAGCCAGTTGGG - Intronic
1172630730 20:36376619-36376641 GGGGAGAGAGAGAGTTAGGAGGG + Intronic
1172837520 20:37882568-37882590 CCGGGGACACAGAGTCAGGAGGG + Intergenic
1173033271 20:39381931-39381953 TTGTACAAACAGAGTAAGGATGG + Intergenic
1173095005 20:40017708-40017730 TTGCAGAAACAGAGACAAGAGGG - Intergenic
1173395331 20:42673875-42673897 GAGGAAAAACAGCGTCAGCATGG - Intronic
1173804104 20:45912643-45912665 GTGGTGACACAGAGACAGGTAGG - Intergenic
1173835683 20:46123734-46123756 GGGGAGAGACAGAGGCAGGGAGG - Intronic
1173876632 20:46376421-46376443 GTGGGGAGGGAGAGTCAGGAGGG - Intronic
1174466371 20:50720742-50720764 ATGAAGAAACTGAGTCAGGAAGG + Intergenic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1174891132 20:54395735-54395757 GTGGAGAGATGGAATCAGGATGG + Intergenic
1175217679 20:57400138-57400160 ATGGGGAAACAGAGGCCGGAGGG + Intronic
1175383912 20:58582117-58582139 GTGGAGGAACAGGGAAAGGAGGG + Intergenic
1175755207 20:61525300-61525322 CAGGAGAAAGAGGGTCAGGAGGG + Intronic
1175944521 20:62552503-62552525 GAGGAGCAACAGAGTCATGTTGG + Intronic
1176707655 21:10127522-10127544 GTGGACAAACAGGATCAAGATGG - Intergenic
1178282365 21:31294398-31294420 GTGGAGAAGCAGAGTTAGAAAGG - Intronic
1178423632 21:32461461-32461483 ATGCAGAAAAAGAGGCAGGAAGG - Intronic
1178895488 21:36553877-36553899 GTGGCTAAACAGAGTCAACATGG - Intronic
1178928981 21:36800556-36800578 GTGAGGAAACAGAGGCAGGAAGG + Intronic
1179089698 21:38253164-38253186 GTGGGGAAAGCAAGTCAGGAAGG - Intronic
1179260858 21:39757200-39757222 GGGGAGAAACAGGGCAAGGAGGG - Intronic
1179292422 21:40030370-40030392 GTGGAGAAGCAAATCCAGGAAGG + Intronic
1179480303 21:41672544-41672566 ATGGAGAAACTGAGGCAGGACGG + Intergenic
1180149889 21:45942129-45942151 GAGGGGAAACCGAGTCAGCATGG - Exonic
1180721270 22:17910552-17910574 ATGGATGAACAGAGGCAGGATGG + Intronic
1181313002 22:21955650-21955672 GTGCAGAAGCATAGTAAGGAAGG + Intergenic
1181346109 22:22221722-22221744 GTGCAGAAGCATAGTAAGGAAGG + Intergenic
1181446465 22:22979061-22979083 TTGGAGGAACAGTGCCAGGAAGG - Intergenic
1181569524 22:23760542-23760564 GTGGAGAGACAGAGACAGAGGGG + Intergenic
1181631731 22:24155259-24155281 GATGAGAAACAGGCTCAGGAGGG - Intronic
1181670529 22:24423809-24423831 GCGGAGAAACCGAGGCCGGAGGG - Intronic
1181982734 22:26777348-26777370 CTGAAGAAACAGAGTCAGAGAGG - Intergenic
1182078496 22:27511733-27511755 ATGGAGAAACAGGTTCAGGGAGG - Intergenic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182747251 22:32615475-32615497 ATGGAGAAATGGAGTCAGGGAGG + Intronic
1183733080 22:39629188-39629210 GTGGAGCACCAGGGTGAGGACGG - Intronic
1183786441 22:40031594-40031616 ATGGAGAAACTGAGGCAGAAAGG - Exonic
1184064602 22:42110518-42110540 TTGAAGAAACAGAGTCAGGAAGG - Intergenic
1184212146 22:43042372-43042394 GAGGAGAATCAGAGCCAAGATGG + Intronic
1184723966 22:46332329-46332351 GTGGAGAAACCCAGACAGAAAGG - Intronic
949904668 3:8849035-8849057 GTGCAGAAGCAGAGACAGGGAGG - Intronic
950153534 3:10706760-10706782 GTGGGGAAACTGAGTCAGAGAGG + Intronic
950571833 3:13805545-13805567 GTGGAGAACAAGAGACAGAAAGG - Intergenic
954582164 3:51708764-51708786 GTGGGGAGGCAGAGTCAGAAGGG + Intronic
954752474 3:52821435-52821457 GTGTAGAAACAGCAGCAGGAAGG + Intronic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
956666572 3:71647855-71647877 GTGGAAAAATATATTCAGGATGG + Intergenic
956726191 3:72158438-72158460 ATGGAGAGAGAGAGACAGGAAGG + Intergenic
957272618 3:78051345-78051367 GTGGGGAGGCAGAGGCAGGAGGG - Intergenic
958169934 3:89926720-89926742 GTGGAGAAACGAAGGCAGAAAGG - Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
958962760 3:100525746-100525768 GGGGAGAAACAGACCCATGAAGG + Intronic
959572522 3:107900268-107900290 GGTGAGAAAAAGAGTTAGGAAGG - Intergenic
960298833 3:115976777-115976799 GAGGAGAAAGAGAGTTAAGAGGG - Intronic
960375007 3:116890076-116890098 GTGCAGAAACGGATCCAGGAAGG - Intronic
960818719 3:121703470-121703492 GAGAAGAAAAAGAGTTAGGAAGG + Intronic
960885345 3:122388215-122388237 TTGGAGATACTGAGTAAGGAAGG + Intronic
960983489 3:123254469-123254491 GTGGGGAAACAGAGACAGGAAGG - Intronic
961217629 3:125172715-125172737 GTGGAGAAACTGAGTGAAGGAGG + Intronic
961321490 3:126079494-126079516 ATGGAGAAACTGACACAGGATGG + Intronic
961410259 3:126715289-126715311 ATGAAGAAACTGAGTCAGGGAGG - Intronic
961431405 3:126886568-126886590 GAGGGGAAACAGAGTCACAATGG - Intronic
961538594 3:127585473-127585495 GAGGAGGAACAGAGACAGGGAGG + Intronic
961550713 3:127669245-127669267 TTTGAGGAACAGAGACAGGAGGG - Intronic
963123478 3:141795081-141795103 CTGGAGTCACAGGGTCAGGAAGG + Intronic
963311470 3:143714804-143714826 GTGGGGAAGAAGAGTCAGGTTGG + Intronic
964961718 3:162436190-162436212 TTGGAGAAACAGGGCCAGGAAGG + Intergenic
965120380 3:164547004-164547026 GAGGAGAAAGAGAGCAAGGAGGG - Intergenic
965129200 3:164673163-164673185 GTGGAGAAACATAGTCAAAAAGG - Intergenic
965815238 3:172629379-172629401 GCGAAGAAACACACTCAGGAAGG + Intergenic
966779235 3:183569415-183569437 GTGCAGAAACAAACACAGGAGGG + Intergenic
966836279 3:184051637-184051659 GGGGAGAAAGAGAGGCAGAAAGG - Intergenic
966959181 3:184916405-184916427 TTGGAGAAAAAAAGACAGGACGG + Intronic
967348128 3:188481560-188481582 TTAGAGAAACAGAGTAAAGAAGG + Intronic
969030301 4:4206748-4206770 GTGGGAAAACAGATTCAGCAAGG - Intronic
969533185 4:7740686-7740708 GTGAAGAAGCAAAGTCAGGGAGG - Exonic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970821294 4:20218284-20218306 GTGGGGAGAGAAAGTCAGGATGG - Intergenic
971262621 4:25070742-25070764 GTGGGGACACAGAGTAGGGAAGG - Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972714701 4:41633828-41633850 CTGGAGAAACAAAGTCACAAGGG - Intronic
974179852 4:58370654-58370676 GTGGAGGAATAGAGAGAGGAAGG - Intergenic
974488484 4:62534030-62534052 GTGGAGAAATAGAGGCATCAAGG + Intergenic
975259972 4:72286942-72286964 GTAGAGAAAAAGAGGCTGGAAGG + Intronic
975769272 4:77703756-77703778 GGGGAGAAACCCAGTCTGGAGGG + Intergenic
975955339 4:79830527-79830549 GTGGAGAAAGGAAGTAAGGAGGG + Intergenic
976357572 4:84137131-84137153 GTGCAGAAGCAGAGGCAGGGTGG - Intergenic
976616537 4:87083711-87083733 GTGGGGAAACACAGTAATGATGG - Intronic
977186665 4:93946810-93946832 GTGGAGCAAAAGAATCAAGAAGG - Intergenic
977271101 4:94917970-94917992 CAGGAGAAAGAGAGTGAGGAGGG - Intronic
978093186 4:104742838-104742860 GGGCAGAAACAGGATCAGGAAGG - Intergenic
978160657 4:105543686-105543708 GTGAAGAAACTGAGTCAGGGAGG + Intergenic
978203985 4:106057620-106057642 GGGGAGGACCACAGTCAGGAGGG - Intronic
979132365 4:117063329-117063351 GGGGAGAGACAGAGTGAGAAGGG - Intergenic
981073075 4:140565588-140565610 GTGAAGCCACAGAGACAGGAGGG - Intronic
981648602 4:147028937-147028959 GTGGAGAAAGTGAGTCAAGTTGG - Intergenic
982712358 4:158769506-158769528 GTGGAGAAAGAGCGGGAGGAAGG - Intronic
982743959 4:159087006-159087028 CTTGAGAGACAGAGGCAGGAGGG + Intergenic
983299614 4:165908660-165908682 TTGGAGATACAGAGTCAGAGAGG + Intronic
984032182 4:174617969-174617991 ATTGAGAAAAAGAGTCAGGCTGG + Intergenic
984206869 4:176795590-176795612 GTGGAGAAAGAGAGGTAGCAGGG + Intergenic
984373357 4:178894757-178894779 GTGGATAACCAGAGTGAGCAAGG + Intergenic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
985040043 4:185880986-185881008 GTGAAGAAAAAGAGAAAGGAAGG + Intronic
985132146 4:186749677-186749699 GTGGGGGAAGAGAGACAGGAAGG - Intergenic
985286534 4:188341835-188341857 TAGGAGAAACTGAGTTAGGACGG - Intergenic
985394841 4:189531238-189531260 GTGGAGAAGCAAAGGCAGGTGGG + Intergenic
985901683 5:2800651-2800673 GTGGGGAAACGGAAGCAGGAAGG + Intergenic
986537156 5:8801553-8801575 GAGGAGAAAGAAAGGCAGGAAGG + Intergenic
987198857 5:15554291-15554313 GGGGAGATATAGAGTGAGGAAGG - Intronic
987229404 5:15877911-15877933 GAAGAGACACAGAGTAAGGATGG - Intronic
987240366 5:15992105-15992127 GAGGAGAAACAGAGAGAGAAAGG - Intergenic
989203882 5:38792594-38792616 GTGAGGAAAGAGAGTGAGGATGG - Intergenic
989405798 5:41059111-41059133 AAAGAGAAACAGAGTCAGGTGGG - Intronic
990868321 5:60403754-60403776 CTGGAGAGACAGCATCAGGAAGG - Intronic
992609272 5:78493264-78493286 GTGGAGAACCAGGGCCAGGCTGG - Intronic
992849973 5:80797193-80797215 GTGGAGAAATAGAGTGGCGAGGG - Intronic
993594684 5:89838574-89838596 CAGGAGAAACAAAGTTAGGATGG + Intergenic
994470874 5:100204391-100204413 GAGAAAAAACAGAGCCAGGAGGG + Intergenic
994805470 5:104441873-104441895 GTGTTAAAACAGAGTCAAGAAGG + Intergenic
997453333 5:134000696-134000718 ATGGAGAAAGAGAGCCTGGATGG + Intronic
997532300 5:134589253-134589275 TAGGAGGCACAGAGTCAGGACGG + Intergenic
997787212 5:136724429-136724451 ATGTAGAAACATAGACAGGAAGG - Intergenic
997851603 5:137337962-137337984 ATAGAGAAACAGACTCAGGGAGG - Intronic
999248996 5:150170621-150170643 GTGGAGAGACAGAGGCAGCCAGG - Intronic
999505640 5:152193140-152193162 TAGGAGAAACAGAGGCAGCAGGG - Intergenic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
1001832970 5:174805080-174805102 GTGAAGACACAGATGCAGGAGGG - Intergenic
1001975415 5:175994745-175994767 GCTGGGAAACAGACTCAGGAGGG + Intronic
1002101741 5:176861321-176861343 GTGAGGAAACAGGTTCAGGATGG + Intronic
1002242018 5:177849025-177849047 GCTGGGAAACAGACTCAGGAGGG - Intergenic
1002372973 5:178769448-178769470 GCACAGAAACAGAGGCAGGAGGG + Intergenic
1002419087 5:179136199-179136221 TAGGAGACACAGAGACAGGAAGG - Intronic
1002701291 5:181127072-181127094 GTGGAGAAACGGCAGCAGGAAGG - Intergenic
1003452149 6:6244965-6244987 GTGGAGAAACTGAGTCACAGAGG + Intronic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004160853 6:13211643-13211665 GTGGGGAACCAGAGAAAGGAAGG - Intronic
1005368517 6:25105167-25105189 GTGAAGAGACAGAGTAAAGATGG + Intergenic
1006324700 6:33344909-33344931 GTGGAGAGTCAGACACAGGAAGG + Intergenic
1006379573 6:33689639-33689661 TTGGAGCAACAGGGTCAGGGTGG + Intronic
1006951085 6:37821059-37821081 TTGGAGACATAGAGGCAGGAAGG + Intronic
1008339037 6:50342543-50342565 GTGGAGAAAGATAGCAAGGATGG - Intergenic
1010249160 6:73690852-73690874 GTGGAGAAAGAAAGAGAGGAAGG + Intergenic
1010413265 6:75584959-75584981 GTGGGGGCACAGAGTCAGGCTGG + Intergenic
1010638017 6:78283947-78283969 GTGCAGAAACAGAGTTGGGGAGG - Intergenic
1010724518 6:79318104-79318126 ATGGAGCAACAGAGCCTGGATGG - Intergenic
1010833457 6:80557878-80557900 GGGGAGAAAAAGAGTTGGGAGGG - Intergenic
1011407111 6:87027486-87027508 GTGTAGAACCAGAGCCATGAAGG + Intergenic
1011680389 6:89777742-89777764 GTGGGGTAACTGAGTCAGGTGGG - Intronic
1012060962 6:94479963-94479985 GTGGAGGAATAGAGATAGGAAGG - Intergenic
1013207825 6:107960060-107960082 GTGCAGAAAAAAAGTGAGGAGGG - Intergenic
1013624672 6:111925469-111925491 GAGGAGGAAATGAGTCAGGAAGG + Intergenic
1015144266 6:129968024-129968046 CTGGAGAAACAGAGTTTGCAAGG + Intergenic
1016554345 6:145318774-145318796 AAGGAGAAACTGAGTAAGGAAGG + Intergenic
1016999752 6:149988555-149988577 GTGAGGAAGAAGAGTCAGGAGGG + Intergenic
1017006864 6:150033719-150033741 GTGAGGAAGAAGAGTCAGGAGGG - Intergenic
1017577906 6:155826079-155826101 GTGGGGAAACACAGCAAGGAAGG - Intergenic
1017759723 6:157558667-157558689 GTGGAAAAACAGAATCATAAGGG - Intronic
1017996774 6:159538403-159538425 GGGGAGAAAGAGAGGAAGGAAGG + Intergenic
1018832623 6:167456176-167456198 GTGGAGAAATAAAGCCAGAAGGG - Intergenic
1018957593 6:168420476-168420498 GTTGTGAAGCACAGTCAGGATGG + Intergenic
1019115542 6:169758500-169758522 GTGGTTAAACAGAGGCAGCAGGG - Intronic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1020512338 7:9073411-9073433 TTGGAGAAGCTGAGGCAGGAGGG - Intergenic
1020513561 7:9089735-9089757 GTGGAAAAACAGAGTCCCCAGGG + Intergenic
1020927837 7:14355152-14355174 GTGGAGAAAGAGAGAGAGGGAGG - Intronic
1021088680 7:16454686-16454708 GTGGAGACCCAGCTTCAGGAGGG - Intergenic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1022445832 7:30469944-30469966 GGGGAGAAACAGAGTAAGGTGGG - Intronic
1023780008 7:43646733-43646755 GTGGAGTTGCAGAGTCTGGAGGG - Intronic
1024316932 7:48028912-48028934 GTGGAAAAACAAAGGCAAGAAGG - Exonic
1024820238 7:53320223-53320245 GAGGAGAAACAAAGTGAAGAAGG - Intergenic
1024867859 7:53924522-53924544 GTGGAGGAATTGGGTCAGGAGGG - Intergenic
1025744887 7:64233938-64233960 GAGAAGAAAGAGAGTCAAGAAGG + Intronic
1025753494 7:64313030-64313052 GTTGAGAAACAGTCTCAGGGAGG - Intronic
1027330863 7:77091125-77091147 GTGGACAAAGATAGTTAGGATGG + Intergenic
1027645615 7:80794212-80794234 GTGGATAAATTGAGTAAGGAAGG - Intronic
1028426652 7:90696906-90696928 GTGAAGAAAGAGTTTCAGGAAGG + Intronic
1029476136 7:100785959-100785981 GAAGAGAAAGAGAGTGAGGAGGG - Intronic
1029784902 7:102780214-102780236 GTGGACAAAGATGGTCAGGATGG - Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1031337993 7:120561486-120561508 GTGAGGAAACAGATTCAGAAAGG + Intronic
1031400467 7:121321183-121321205 GTCCAAAAAGAGAGTCAGGAAGG - Intergenic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1031997368 7:128241386-128241408 CCGGGGAAACTGAGTCAGGAGGG + Intronic
1032469812 7:132170136-132170158 GTGAAGAAACTGAGTCACTAAGG - Intronic
1032802288 7:135326305-135326327 GTGCAGATACTGAGTTAGGATGG - Intergenic
1033610615 7:142960756-142960778 GGGGAGTAAAAGAGGCAGGATGG - Intronic
1033897580 7:146093716-146093738 GTGAAGAAACAAAGTGAGAAGGG + Intergenic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034353438 7:150432299-150432321 ATGGAGAAACACAGTCTGGTGGG + Intergenic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1035044081 7:155952671-155952693 GGGGAGAAACACAGTGGGGAGGG + Intergenic
1035168932 7:157007286-157007308 GAGGAGAAAAAGAGGAAGGAAGG + Intronic
1035234748 7:157489037-157489059 GTGAAGACACAGACCCAGGAGGG + Intergenic
1035417485 7:158702524-158702546 CTGGAAAAACACAGGCAGGATGG - Intronic
1035749610 8:1987167-1987189 GTGTAAAAACAGAGAGAGGAAGG - Intronic
1036700094 8:11007740-11007762 GTGGAGGAACAGAGGCAGCAGGG + Intronic
1036828256 8:11997067-11997089 GAGGTGAAAGAGAATCAGGAGGG - Intergenic
1037142513 8:15536154-15536176 GTGTAGAGACAGAGTCTGCACGG + Intronic
1037703843 8:21298438-21298460 GGGGAGAAGCAGTATCAGGAGGG - Intergenic
1038012464 8:23486046-23486068 AGGGAGAAAGAGAGTCAGGGAGG - Intergenic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1038290415 8:26244273-26244295 GTGAGGAAACAGACTCAGAAAGG - Intergenic
1038858501 8:31359708-31359730 GTTGAAAATCAGAGTTAGGAGGG - Intergenic
1039031493 8:33314484-33314506 GAGGGGAAACAGAGTCAGAGTGG - Intergenic
1039118293 8:34116852-34116874 GAGGAGAAAGAGAATCAGGGAGG + Intergenic
1039311883 8:36325224-36325246 TTGGATACACAGAGGCAGGATGG - Intergenic
1039727410 8:40233751-40233773 GTGAAGACACAGAGACAGAATGG + Intergenic
1039775157 8:40728650-40728672 GGGGAAAGAGAGAGTCAGGAAGG + Intronic
1039894711 8:41708601-41708623 ATGAATAAACAGAGTCAGAAAGG - Intronic
1040526460 8:48229469-48229491 TTGGAGAAACAGGGCCAGGCAGG - Intergenic
1040581954 8:48705533-48705555 GTGGAGAAAAACAGCCAGGAGGG + Intergenic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1042187617 8:66152633-66152655 CTGTAGAAAGAGACTCAGGAGGG - Intronic
1042966033 8:74352982-74353004 GAGGAAAAACAGTGTAAGGAGGG - Intronic
1045327354 8:101126902-101126924 GGGGAGACACAGTGACAGGACGG - Intergenic
1048573437 8:135672999-135673021 CTGGAGAATCAGATTCAGGGCGG - Intergenic
1048947842 8:139466749-139466771 GTGAAAGAATAGAGTCAGGATGG - Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049483890 8:142841350-142841372 GTGCAGAAACGCACTCAGGATGG - Intronic
1049617303 8:143581231-143581253 GTGGAGAACCAGAGTCTGCGTGG - Exonic
1049702449 8:144021323-144021345 GGGGAGAAACTGGGTCATGAGGG - Intronic
1051477332 9:17522448-17522470 GTGAAGAATCAAGGTCAGGATGG - Intergenic
1051683123 9:19628386-19628408 ATGGAGAAAGAGAGGCAAGAAGG + Intronic
1053761133 9:41350592-41350614 GTGGACAAACAGGATCAAGATGG + Intergenic
1054325870 9:63712139-63712161 GTGGACAAACAGGATCAAGATGG - Intergenic
1054858847 9:69929302-69929324 TTGAAGAAATAGAGTCAGGAAGG - Intergenic
1055717501 9:79133951-79133973 GAGGAGAAAAAGAGACAGGTAGG + Intergenic
1056077626 9:83058018-83058040 GAGGAGAAACTGAGGCAAGATGG + Intronic
1056802760 9:89704763-89704785 TAGGAGAAACAGTGTCTGGAAGG + Intergenic
1057108852 9:92447829-92447851 GAGGAAAAACAGAGTCAATAGGG + Intronic
1057995284 9:99817333-99817355 GTGGAGAAGAAGAGGAAGGAGGG + Intergenic
1058056687 9:100455932-100455954 GTGGAGAAACAGCGCTGGGAAGG - Intronic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1059104488 9:111500037-111500059 GTGGAGGAACAGTCTCAGGGTGG + Intergenic
1059302017 9:113321422-113321444 GTGGAGAATCAGAGTGGGAATGG + Intronic
1059691074 9:116686940-116686962 ATGGAAAAACAGATTCAGTAAGG + Intronic
1060038821 9:120282098-120282120 GTGGAAAAACAAAGTGACGATGG + Intergenic
1060198938 9:121640622-121640644 GTTCAGCATCAGAGTCAGGAGGG + Intronic
1060243903 9:121927863-121927885 GTGGAAAAACCTAGTCATGAAGG + Intronic
1060592761 9:124829366-124829388 GTGGAGAGAGAGAGAGAGGAAGG - Intergenic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061407919 9:130402946-130402968 GTGGAGAGCCAGAGGCAGGTGGG + Intronic
1062103750 9:134741591-134741613 GTACAGAAGCAGAGGCAGGAGGG + Intronic
1062606522 9:137351066-137351088 GTGGAGAAGCAGATTCTGGGCGG - Exonic
1202792400 9_KI270719v1_random:96402-96424 GTGGACAAACAGGATCAAGATGG - Intergenic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1187852381 X:23604009-23604031 GAGGAGGCCCAGAGTCAGGATGG - Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188618188 X:32185347-32185369 GTGAAGAAACAGATTCAGGAAGG - Intronic
1189909644 X:45797228-45797250 ATGGAGAAACTGAGTCCTGAAGG - Intergenic
1190330439 X:49231932-49231954 ATGGAGAAACTGTGTCAGGGAGG + Intronic
1193300860 X:79886862-79886884 GTGGAGGAACTCAGCCAGGAGGG - Intergenic
1195091394 X:101463081-101463103 ATGGAGAAAGAGAGACAGAATGG - Intronic
1195272162 X:103242685-103242707 CTGGAGAAAGAGGGTCAGGAGGG - Intergenic
1195473889 X:105262723-105262745 TTGGAGAAACAGAGCTTGGAAGG + Intronic
1199665035 X:150089688-150089710 GTGGAGAAACAGCATCACTAGGG + Intergenic
1199732703 X:150652222-150652244 GTGGAAAAACAGAGCCAGCATGG + Intronic
1200266565 X:154649319-154649341 CTGGAGACACAGCTTCAGGAAGG + Intergenic
1200958460 Y:8973633-8973655 GGGGAGAAACAGAGCCAGGCGGG - Intergenic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic
1202588884 Y:26461258-26461280 GTGGTGAAAGAAGGTCAGGATGG + Intergenic