ID: 1073794452

View in Genome Browser
Species Human (GRCh38)
Location 10:106972734-106972756
Sequence TACTATGGGAATAAAGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073794448_1073794452 17 Left 1073794448 10:106972694-106972716 CCAAGCTGAAAGGTTTGAGTTGA No data
Right 1073794452 10:106972734-106972756 TACTATGGGAATAAAGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073794452 Original CRISPR TACTATGGGAATAAAGAGAA GGG Intronic
No off target data available for this crispr