ID: 1073799511

View in Genome Browser
Species Human (GRCh38)
Location 10:107026030-107026052
Sequence GCAACCTATGGTGGATTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073799511_1073799523 27 Left 1073799511 10:107026030-107026052 CCTGAAAATCCACCATAGGTTGC No data
Right 1073799523 10:107026080-107026102 AAAGGAAATCACAGGCATGGAGG No data
1073799511_1073799515 9 Left 1073799511 10:107026030-107026052 CCTGAAAATCCACCATAGGTTGC No data
Right 1073799515 10:107026062-107026084 ATCCCCCCACACACATCAAAAGG No data
1073799511_1073799521 19 Left 1073799511 10:107026030-107026052 CCTGAAAATCCACCATAGGTTGC No data
Right 1073799521 10:107026072-107026094 ACACATCAAAAGGAAATCACAGG No data
1073799511_1073799522 24 Left 1073799511 10:107026030-107026052 CCTGAAAATCCACCATAGGTTGC No data
Right 1073799522 10:107026077-107026099 TCAAAAGGAAATCACAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073799511 Original CRISPR GCAACCTATGGTGGATTTTC AGG (reversed) Intronic
No off target data available for this crispr