ID: 1073799513

View in Genome Browser
Species Human (GRCh38)
Location 10:107026039-107026061
Sequence CTCAATCCTGCAACCTATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 53}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073799513_1073799521 10 Left 1073799513 10:107026039-107026061 CCACCATAGGTTGCAGGATTGAG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1073799521 10:107026072-107026094 ACACATCAAAAGGAAATCACAGG No data
1073799513_1073799522 15 Left 1073799513 10:107026039-107026061 CCACCATAGGTTGCAGGATTGAG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1073799522 10:107026077-107026099 TCAAAAGGAAATCACAGGCATGG No data
1073799513_1073799524 23 Left 1073799513 10:107026039-107026061 CCACCATAGGTTGCAGGATTGAG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1073799524 10:107026085-107026107 AAATCACAGGCATGGAGGTAAGG No data
1073799513_1073799523 18 Left 1073799513 10:107026039-107026061 CCACCATAGGTTGCAGGATTGAG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1073799523 10:107026080-107026102 AAAGGAAATCACAGGCATGGAGG No data
1073799513_1073799515 0 Left 1073799513 10:107026039-107026061 CCACCATAGGTTGCAGGATTGAG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1073799515 10:107026062-107026084 ATCCCCCCACACACATCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073799513 Original CRISPR CTCAATCCTGCAACCTATGG TGG (reversed) Intronic
905858001 1:41327564-41327586 CCCAATCCTGCAACCCCTGCTGG - Intergenic
907825564 1:58013610-58013632 CTCCTTCCTGCAACATCTGGAGG + Intronic
922455573 1:225771106-225771128 CTCAATGCTGCCTCCTCTGGGGG - Intergenic
1062816051 10:500831-500853 CTGAAGCCTGAAACCTATGGGGG - Intronic
1065512759 10:26495383-26495405 CTCATTCCTGCAGCCAGTGGGGG + Intronic
1069238593 10:66109565-66109587 CTTACTCCTGCTACCTATGTTGG - Intronic
1073799513 10:107026039-107026061 CTCAATCCTGCAACCTATGGTGG - Intronic
1076428377 10:130383488-130383510 CTCCATCCTTCAATCTATGGGGG + Intergenic
1081403043 11:42664854-42664876 CTCACTCCTGCAACAAAAGGTGG - Intergenic
1084748159 11:71186446-71186468 CTCTATCCCCCAACCTATGGAGG + Intronic
1085302126 11:75464899-75464921 CTCAGTCCTGCCTCCCATGGAGG + Intronic
1091238086 11:134034826-134034848 CTCAATGCTTCAAGCCATGGTGG - Intergenic
1093360898 12:18226413-18226435 CACATTGCTGCAACCTCTGGGGG - Intronic
1093817010 12:23561240-23561262 CTCACTCCTGCAACCCAAGTAGG + Intronic
1100793132 12:98152467-98152489 CAGACTCCTGAAACCTATGGGGG + Intergenic
1102994989 12:117342287-117342309 CTCAAGCTTACAACCTAGGGTGG + Intronic
1107188074 13:37547274-37547296 CTCAAGCCTGAAGGCTATGGAGG + Intergenic
1109514437 13:63423683-63423705 CTCAGTCCTGCAAGCTTTGTAGG - Intergenic
1109639919 13:65177725-65177747 TTTGATCCTGCAACATATGGTGG - Intergenic
1111112488 13:83732509-83732531 CTCAACCCTGTAACATATGCAGG - Intergenic
1117787019 14:59296665-59296687 CTCACTGCTGTAACCAATGGTGG - Intronic
1119206703 14:72799740-72799762 GTCAATCCTGGAACTTCTGGGGG + Intronic
1123507459 15:20958681-20958703 CTCAATCCTGGGACCAGTGGGGG - Intergenic
1123564685 15:21532422-21532444 CTCAATCCTGGGACCAGTGGGGG - Intergenic
1123600941 15:21969713-21969735 CTCAATCCTGGGACCAGTGGGGG - Intergenic
1202973049 15_KI270727v1_random:259533-259555 CTCAATCCTGGGACCAGTGGGGG - Intergenic
1134387534 16:13787856-13787878 CTCGTGCCTGCAGCCTATGGAGG - Intergenic
1142901721 17:3016341-3016363 CTTAATCCTGCGTCCCATGGAGG + Intronic
1145749712 17:27346585-27346607 CTCACTTCTGAAACCTTTGGAGG - Intergenic
1149540223 17:57463007-57463029 CTTAATCCTGAGACCTGTGGTGG - Intronic
930772401 2:55141324-55141346 CTAACCCCTGGAACCTATGGAGG - Intergenic
1175625138 20:60483630-60483652 TTCAGTCCTCCAAGCTATGGTGG - Intergenic
1182595821 22:31419529-31419551 CTAAAACGTGCAAACTATGGTGG + Intronic
1183016837 22:34995545-34995567 TTCAATTATGCAACCTATGTTGG + Intergenic
953192879 3:40705031-40705053 CTCAAGCTTGCAGCCTATTGTGG + Intergenic
965473178 3:169120768-169120790 TTAAATCCTACAACCTGTGGAGG + Intronic
965490027 3:169324046-169324068 CACATTCCTGCAAGCCATGGAGG - Intronic
972101364 4:35423021-35423043 CTGAATCCTGATACCTGTGGTGG - Intergenic
972539654 4:40028359-40028381 CTAAATCCTGGAAGCTGTGGAGG + Intergenic
973307280 4:48667169-48667191 CCCCATCCTGCTACATATGGGGG - Intronic
977024146 4:91794193-91794215 CCAAATACTGCAAGCTATGGGGG - Intergenic
983208673 4:164936460-164936482 TTCAATGCTGCAGCCTCTGGAGG - Intergenic
1005203066 6:23369154-23369176 CTCACTCCTGCCACCTATCCCGG + Intergenic
1005203918 6:23379274-23379296 CTCATTCCTGGATCCTATGCTGG - Intergenic
1010355581 6:74928691-74928713 CTTCTTCCTGCAACCTAAGGAGG + Intergenic
1017774939 6:157673158-157673180 CTCACTCCTGCTGCCCATGGAGG - Exonic
1018652146 6:166001601-166001623 CCCAACCCTGCAAACTCTGGCGG - Intergenic
1021450191 7:20777652-20777674 ATAAATCTTGCCACCTATGGAGG + Intergenic
1027680274 7:81211744-81211766 CTCACTCCTAGAACCTATTGAGG - Intergenic
1029730709 7:102436106-102436128 CTCAATTCTGTTAACTATGGGGG + Intronic
1038686294 8:29721714-29721736 CTCAATGCTGCAGTCTAGGGTGG - Intergenic
1039536299 8:38317045-38317067 ATCAACCCAGCAAGCTATGGTGG + Intronic
1048022207 8:130549618-130549640 CTCAATCCAACAACCTGTGAGGG - Intergenic
1050297928 9:4225474-4225496 CTCATTCCTGCAACCTAACGAGG + Intronic
1052525158 9:29608166-29608188 CTCAATCCAGCAAAGCATGGAGG + Intergenic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1059423721 9:114207963-114207985 CTCAAACAAGCAACCAATGGAGG - Intronic
1199493626 X:148428349-148428371 CTGAATGCTGCATCCTCTGGAGG + Intergenic