ID: 1073799513

View in Genome Browser
Species Human (GRCh38)
Location 10:107026039-107026061
Sequence CTCAATCCTGCAACCTATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073799513_1073799515 0 Left 1073799513 10:107026039-107026061 CCACCATAGGTTGCAGGATTGAG No data
Right 1073799515 10:107026062-107026084 ATCCCCCCACACACATCAAAAGG No data
1073799513_1073799522 15 Left 1073799513 10:107026039-107026061 CCACCATAGGTTGCAGGATTGAG No data
Right 1073799522 10:107026077-107026099 TCAAAAGGAAATCACAGGCATGG No data
1073799513_1073799524 23 Left 1073799513 10:107026039-107026061 CCACCATAGGTTGCAGGATTGAG No data
Right 1073799524 10:107026085-107026107 AAATCACAGGCATGGAGGTAAGG No data
1073799513_1073799521 10 Left 1073799513 10:107026039-107026061 CCACCATAGGTTGCAGGATTGAG No data
Right 1073799521 10:107026072-107026094 ACACATCAAAAGGAAATCACAGG No data
1073799513_1073799523 18 Left 1073799513 10:107026039-107026061 CCACCATAGGTTGCAGGATTGAG No data
Right 1073799523 10:107026080-107026102 AAAGGAAATCACAGGCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073799513 Original CRISPR CTCAATCCTGCAACCTATGG TGG (reversed) Intronic