ID: 1073799514

View in Genome Browser
Species Human (GRCh38)
Location 10:107026042-107026064
Sequence GATCTCAATCCTGCAACCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 87}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073799514_1073799515 -3 Left 1073799514 10:107026042-107026064 CCATAGGTTGCAGGATTGAGATC 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1073799515 10:107026062-107026084 ATCCCCCCACACACATCAAAAGG No data
1073799514_1073799524 20 Left 1073799514 10:107026042-107026064 CCATAGGTTGCAGGATTGAGATC 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1073799524 10:107026085-107026107 AAATCACAGGCATGGAGGTAAGG No data
1073799514_1073799522 12 Left 1073799514 10:107026042-107026064 CCATAGGTTGCAGGATTGAGATC 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1073799522 10:107026077-107026099 TCAAAAGGAAATCACAGGCATGG No data
1073799514_1073799523 15 Left 1073799514 10:107026042-107026064 CCATAGGTTGCAGGATTGAGATC 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1073799523 10:107026080-107026102 AAAGGAAATCACAGGCATGGAGG No data
1073799514_1073799521 7 Left 1073799514 10:107026042-107026064 CCATAGGTTGCAGGATTGAGATC 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1073799521 10:107026072-107026094 ACACATCAAAAGGAAATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073799514 Original CRISPR GATCTCAATCCTGCAACCTA TGG (reversed) Intronic
902615949 1:17623622-17623644 CAGCTCAGTTCTGCAACCTAGGG + Intronic
905244781 1:36605127-36605149 GCCCTCAGTCCTGCAACCTCAGG + Intergenic
910461374 1:87451224-87451246 CATCTCACTCCTGCAGCCTGGGG + Intergenic
912436774 1:109667896-109667918 GATCTCTCTCCTGAAACCCACGG + Intronic
912452603 1:109776605-109776627 GAGCTCAATCTTGCCACCTGTGG - Intergenic
920671804 1:208009347-208009369 GAATTCAAACCTGCAACCTCAGG - Intergenic
921598712 1:217083699-217083721 TATCCCAATTCTGCAACCTTAGG + Intronic
1062885999 10:1016302-1016324 GGGAACAATCCTGCAACCTAAGG - Intronic
1064365261 10:14701761-14701783 GATATCAAACCTGTAACCTTTGG + Intronic
1065122237 10:22541614-22541636 GATCTCAGTGCTGAAACATAAGG - Intronic
1065988248 10:30979239-30979261 GATATCCATCCTGCAGCTTACGG + Intronic
1067155180 10:43775569-43775591 GAGCTCAAGGCTGGAACCTAGGG - Intergenic
1069728791 10:70598268-70598290 GATCCCAGACCTGCAACCTCAGG + Exonic
1073799514 10:107026042-107026064 GATCTCAATCCTGCAACCTATGG - Intronic
1075328723 10:121556363-121556385 CATCTCAATGCTGACACCTAAGG + Intronic
1075784800 10:125041862-125041884 AATCTCAATCATGCAATCAAAGG + Intronic
1077829961 11:5856810-5856832 GCCCTCAATCCTGTAATCTATGG - Exonic
1080210272 11:29777949-29777971 GATCTCAAACATCCAACCTCAGG - Intergenic
1085958574 11:81432021-81432043 GACTTCAATCCTACAACTTATGG + Intergenic
1088764293 11:112961606-112961628 GATTACAATGCTGCAAACTAAGG + Exonic
1092844502 12:12571511-12571533 GATCTCAAACCCCCAACCTCAGG - Intergenic
1096082951 12:48844934-48844956 GATCTCAATCTTCCGACCTCAGG - Intronic
1103604560 12:122077547-122077569 GATCCAAATCCTCCAACCTGTGG + Intergenic
1103990096 12:124793205-124793227 GCTCACATTCCTGCAACCCAGGG + Intronic
1104066553 12:125311575-125311597 GATCTCATTCCTGGAATCTGCGG + Intronic
1105937837 13:25118324-25118346 AATCCCAATTCTGCAACCAATGG + Intergenic
1106063333 13:26317847-26317869 GATCTTAAACCAGCAACCTAAGG + Intronic
1110985124 13:81957158-81957180 GATCACATTCCTGCAAGCTCAGG + Intergenic
1112872015 13:103984263-103984285 GATCCCAAACCTTCATCCTAGGG + Intergenic
1116644595 14:47510273-47510295 GATTTCAAGCCTGCAGCCTCCGG + Intronic
1118525914 14:66642453-66642475 GACATCAATCCTGTAACCAAAGG + Intronic
1119110222 14:71965669-71965691 GATCTCAATCTTGCAACTCTTGG - Intronic
1119541978 14:75445223-75445245 GATCTCCATGCTCCAACCTCAGG - Intronic
1119623428 14:76150750-76150772 GGTCTCAATCCCCCAACCTCAGG + Intergenic
1122852675 14:104545479-104545501 CATCTCCCTCCTGCAACCTGGGG - Intronic
1123507462 15:20958684-20958706 GATCTCAATCCTGGGACCAGTGG - Intergenic
1123564688 15:21532425-21532447 GATCTCAATCCTGGGACCAGTGG - Intergenic
1123600944 15:21969716-21969738 GATCTCAATCCTGGGACCAGTGG - Intergenic
1126373671 15:47972988-47973010 GATCTCAATCCTGCATCCACAGG + Intergenic
1128366553 15:67007713-67007735 GATCTCAAACTCCCAACCTAAGG - Intergenic
1129791592 15:78344242-78344264 GGTCTCAAACTTGCAACCTCAGG - Intronic
1131729731 15:95267264-95267286 GGTCTTAATCCTGCAACCCAAGG - Intergenic
1202973052 15_KI270727v1_random:259536-259558 GATCTCAATCCTGGGACCAGTGG - Intergenic
1135155424 16:20048747-20048769 GGTCTCAAACCTGCAACCCATGG - Intronic
1136631725 16:31492907-31492929 CCTCTCATTCCTCCAACCTAGGG - Intronic
1140558460 16:75948359-75948381 GATCTTAGTTCTACAACCTAAGG + Intergenic
1142016190 16:87749036-87749058 GATGTTTATCTTGCAACCTAGGG - Intronic
1149262273 17:54892900-54892922 GATCTCGAACTTGCGACCTAAGG + Intergenic
1161339295 19:3732005-3732027 GATCTCCTTCCTGCAGCCCACGG - Exonic
1166718300 19:44983175-44983197 GCTCTGAATCCTACAAGCTAAGG - Intronic
930052518 2:47227754-47227776 GATCTCCATCCTGTTACCAAGGG - Intergenic
931659216 2:64542570-64542592 GATCTCAGTCCTTCAACCTTGGG + Intronic
933639567 2:84745184-84745206 GAACTCAATCCTGCACTCCATGG - Exonic
935740539 2:106143700-106143722 GACCTCAGTCCTGCAGCCTCAGG - Intronic
936947636 2:117944970-117944992 GAGCTAAATCCTACAACCTTTGG + Intronic
937951336 2:127390158-127390180 GATGTCAATCCTACAACCACAGG - Intergenic
944456945 2:199905105-199905127 GATATAAATCCTTCAACCAATGG + Intergenic
948037258 2:234868139-234868161 GCTCTCAATACTGCAATCAACGG - Intergenic
948462129 2:238134846-238134868 CATCTCCATCCTGCCATCTATGG - Intergenic
1171151222 20:22827941-22827963 GATCCCCATCCTGCAGCATAAGG + Intergenic
1172917273 20:38452454-38452476 TACCTCAATCCTGCAACCTGGGG + Intergenic
1182643033 22:31783640-31783662 GATCTCACTCTTGCCACCCAAGG - Intronic
1184419874 22:44373604-44373626 GATCTAAATTCTGCATCCAAAGG + Intergenic
951613873 3:24521579-24521601 AGTCTCAGTCCTGCAGCCTAAGG + Intergenic
953467811 3:43139511-43139533 GATGTCACTCCTGCAACATGTGG + Intergenic
966231666 3:177659008-177659030 GGTCTAAATCCTGAAACCTGTGG - Intergenic
970782760 4:19758699-19758721 AATCACAATCCTGCAACGAATGG + Intergenic
984264935 4:177487201-177487223 GGTCTCAAGCCTGCTACCTTTGG - Intergenic
986103036 5:4631385-4631407 TAGCTGAATCATGCAACCTAAGG - Intergenic
990522487 5:56593412-56593434 GATCTCAATCTCCCAACCTCAGG - Intronic
990750130 5:59005785-59005807 CATTTCAATCCTGTCACCTATGG - Intronic
993224603 5:85151399-85151421 GCTCTCAATCTTTCAACCTCTGG + Intergenic
994540666 5:101091959-101091981 GAACTTAATCCTGCTACCTAAGG + Intergenic
996083883 5:119284302-119284324 GATCTCCATCCTGCAGCCTCTGG - Intronic
997788430 5:136734984-136735006 GTTCTCCATCCTGCAACACAAGG + Intergenic
997980539 5:138465294-138465316 CACCTCCATCCTGCACCCTAGGG - Intergenic
1001981449 5:176040543-176040565 GATCCCACTCCTGGAACCTCAGG - Intergenic
1002236016 5:177803523-177803545 GATCCCATTCCTGGAACCTCAGG + Intergenic
1004572193 6:16857993-16858015 GTTCTGAATACTGAAACCTAAGG - Intergenic
1004960917 6:20787050-20787072 GATTTCAAACCTTCAAGCTAAGG - Intronic
1005045913 6:21642480-21642502 AATATCAATTCTGCAGCCTATGG + Intergenic
1013447869 6:110249414-110249436 GATCTAAATCATGCAGCCCAGGG + Intronic
1025741000 7:64195501-64195523 GGTCTCAATCTTTCAACCTCAGG - Intronic
1032457858 7:132087244-132087266 GATCTGAATCCAGGAACCCAAGG - Intergenic
1037057358 8:14458652-14458674 GATCTCTATCTAGCAACATATGG + Intronic
1041368692 8:57136065-57136087 GATCTCACTCTTGCAACCCTAGG + Intergenic
1041401593 8:57450885-57450907 GATCTTAGTCCTACAACATAAGG + Intergenic
1046834581 8:118785580-118785602 GACCTCACTCCTACAACCAAAGG - Intergenic
1050724787 9:8636425-8636447 GAGCTCCATCTTGCAACCTGGGG + Intronic
1056094600 9:83239849-83239871 GAACTGAATCCAGCAACATATGG - Intergenic
1060441226 9:123641324-123641346 GCTATCAGTCCTGCAATCTAAGG + Intronic
1187925378 X:24244927-24244949 CATCACAATTCTGTAACCTATGG - Intergenic
1193515139 X:82452904-82452926 GTTCTCACTGCTGCAACCAATGG + Intergenic
1195108266 X:101621256-101621278 GATCTGAATGCTCAAACCTAGGG + Intergenic
1196211133 X:112996948-112996970 GATTTCAGAGCTGCAACCTAAGG + Intergenic
1197757333 X:130004989-130005011 CATCTCCATCCTGAAACCTATGG + Intronic
1198549554 X:137730427-137730449 GAACTGAAATCTGCAACCTATGG - Intergenic