ID: 1073799515

View in Genome Browser
Species Human (GRCh38)
Location 10:107026062-107026084
Sequence ATCCCCCCACACACATCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073799514_1073799515 -3 Left 1073799514 10:107026042-107026064 CCATAGGTTGCAGGATTGAGATC 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1073799515 10:107026062-107026084 ATCCCCCCACACACATCAAAAGG No data
1073799506_1073799515 24 Left 1073799506 10:107026015-107026037 CCCCATGAATTCCAACCTGAAAA 0: 1
1: 0
2: 0
3: 29
4: 224
Right 1073799515 10:107026062-107026084 ATCCCCCCACACACATCAAAAGG No data
1073799509_1073799515 13 Left 1073799509 10:107026026-107026048 CCAACCTGAAAATCCACCATAGG 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1073799515 10:107026062-107026084 ATCCCCCCACACACATCAAAAGG No data
1073799513_1073799515 0 Left 1073799513 10:107026039-107026061 CCACCATAGGTTGCAGGATTGAG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1073799515 10:107026062-107026084 ATCCCCCCACACACATCAAAAGG No data
1073799508_1073799515 22 Left 1073799508 10:107026017-107026039 CCATGAATTCCAACCTGAAAATC 0: 1
1: 0
2: 3
3: 19
4: 228
Right 1073799515 10:107026062-107026084 ATCCCCCCACACACATCAAAAGG No data
1073799507_1073799515 23 Left 1073799507 10:107026016-107026038 CCCATGAATTCCAACCTGAAAAT 0: 1
1: 0
2: 1
3: 20
4: 260
Right 1073799515 10:107026062-107026084 ATCCCCCCACACACATCAAAAGG No data
1073799505_1073799515 30 Left 1073799505 10:107026009-107026031 CCAGGACCCCATGAATTCCAACC 0: 1
1: 0
2: 0
3: 3
4: 153
Right 1073799515 10:107026062-107026084 ATCCCCCCACACACATCAAAAGG No data
1073799511_1073799515 9 Left 1073799511 10:107026030-107026052 CCTGAAAATCCACCATAGGTTGC No data
Right 1073799515 10:107026062-107026084 ATCCCCCCACACACATCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073799515 Original CRISPR ATCCCCCCACACACATCAAA AGG Intronic
No off target data available for this crispr