ID: 1073799516

View in Genome Browser
Species Human (GRCh38)
Location 10:107026064-107026086
Sequence TTCCTTTTGATGTGTGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 426
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 379}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073799516_1073799522 -10 Left 1073799516 10:107026064-107026086 CCCCCCACACACATCAAAAGGAA 0: 1
1: 0
2: 5
3: 41
4: 379
Right 1073799522 10:107026077-107026099 TCAAAAGGAAATCACAGGCATGG No data
1073799516_1073799523 -7 Left 1073799516 10:107026064-107026086 CCCCCCACACACATCAAAAGGAA 0: 1
1: 0
2: 5
3: 41
4: 379
Right 1073799523 10:107026080-107026102 AAAGGAAATCACAGGCATGGAGG No data
1073799516_1073799524 -2 Left 1073799516 10:107026064-107026086 CCCCCCACACACATCAAAAGGAA 0: 1
1: 0
2: 5
3: 41
4: 379
Right 1073799524 10:107026085-107026107 AAATCACAGGCATGGAGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073799516 Original CRISPR TTCCTTTTGATGTGTGTGGG GGG (reversed) Intronic
902788602 1:18749681-18749703 GTCCCATTGATGTGGGTGGGTGG + Intergenic
902989589 1:20177261-20177283 TTCCTGTTTATGTCAGTGGGAGG - Intronic
906517787 1:46449697-46449719 TTCCATCTGATCTGTATGGGAGG - Intergenic
907496349 1:54847372-54847394 TTACTTTGGGTGTGTCTGGGAGG + Intergenic
907637216 1:56147632-56147654 TTCTTTGTTGTGTGTGTGGGTGG + Intergenic
908803964 1:67910429-67910451 TCCATATTGATGTGTGTAGGTGG - Intergenic
909118238 1:71567184-71567206 TTCTTTTTGTTGTGTGTGTGTGG + Intronic
909796139 1:79738277-79738299 TTCTTTTCAAGGTGTGTGGGAGG + Intergenic
910085656 1:83399118-83399140 TTCCCTTTGACATGTGTGTGTGG + Intergenic
910235646 1:85033388-85033410 TTCCTTTTTTGGTGTGTGTGTGG - Intronic
910834713 1:91497131-91497153 TTTTTTTTGGTGTGTGTGTGGGG + Intergenic
912344955 1:108955599-108955621 TTCCTTCTGATGTGTCTGAAGGG + Intronic
913322596 1:117599650-117599672 TTCCTCATGATGTGTGTGGTGGG - Intergenic
913366624 1:118046765-118046787 ATTCTTTTTTTGTGTGTGGGGGG + Intronic
914085481 1:144450442-144450464 TTCCTATTCTTGTTTGTGGGGGG - Intronic
916169284 1:161988560-161988582 TGCCTTCTGAGGTGGGTGGGTGG - Intronic
917183502 1:172325033-172325055 TTCTTCTTGGTGTGTGTGTGGGG - Intronic
917336184 1:173926446-173926468 TTATTTTGGATGTGTCTGGGAGG + Intergenic
919742219 1:200988086-200988108 TTCCTTCTGAGGTGGGTGGAAGG - Intronic
919973589 1:202596577-202596599 TTCCCTTTGATGGCTGTGTGAGG - Exonic
920647263 1:207812773-207812795 CTCCTCCTTATGTGTGTGGGGGG + Intergenic
920755950 1:208732630-208732652 TTACTTTGTATGTGTGTAGGGGG - Intergenic
920826513 1:209428181-209428203 TTCCCTTTCATGTCTGGGGGTGG - Intergenic
920839181 1:209539497-209539519 TACCATTTGATGTGTGAGGTAGG - Intergenic
921021422 1:211238989-211239011 TTATTTTGGGTGTGTGTGGGAGG + Intergenic
921253565 1:213319358-213319380 TAACTGTTGATGTGTGTTGGAGG + Intergenic
923605220 1:235437302-235437324 TTCCTTTTGCTGTGTTTCAGTGG + Exonic
924695092 1:246391046-246391068 TTCCTTTTGATGTGAATGTTTGG - Intronic
1065561588 10:26969408-26969430 ATGGTTTTGATGTGTGTGGCTGG - Intergenic
1065757434 10:28945604-28945626 TTCATTATGATGTGTTTTGGTGG + Intergenic
1065800495 10:29347187-29347209 TTCCTTTTTAAGTGTGTGACAGG - Intergenic
1065881261 10:30039456-30039478 TTCCTTTTGAGTTTTCTGGGAGG + Intronic
1066439029 10:35420203-35420225 ATCCTTTGTTTGTGTGTGGGAGG + Intronic
1066442698 10:35454101-35454123 TTACTTTTCCTGTGTGTGGGTGG + Intronic
1067371311 10:45685609-45685631 TTCCTTTTTATGTTTGTGTGGGG + Intergenic
1067388472 10:45840542-45840564 TTCCTTTTTATGTTTGTGTGGGG - Intronic
1067417594 10:46116417-46116439 TTCCTTTTTATGTTTGTGTGGGG + Intergenic
1067439152 10:46298762-46298784 TTGCTATTTATGTGTGTGTGTGG + Intronic
1067445791 10:46344037-46344059 TTCCTTTTTATGTGTGTGTGGGG + Intergenic
1067503008 10:46823305-46823327 TTCCTTTTTATGTTTGTGTGGGG + Intergenic
1067591588 10:47516705-47516727 TTCCTTTTTATGTGTGTGTGGGG - Intronic
1067638703 10:48024780-48024802 TTCCTTTTTATGTGTGTGTGGGG - Intergenic
1067874779 10:49995525-49995547 TTTCTTTTTATGTGTGTGTGTGG + Intronic
1068553410 10:58431374-58431396 TTTAGTTTTATGTGTGTGGGAGG + Intergenic
1068755831 10:60651867-60651889 TTTGTTTTGTTGTGTGTGAGAGG - Intronic
1069234330 10:66051024-66051046 TTCCTTTTTATTTTTGTGGTGGG + Intronic
1069244629 10:66188557-66188579 TTCCATTTTCTGTGTGTGTGTGG + Intronic
1069551067 10:69364687-69364709 TTCCTTTCTGTGTGTGTGGGAGG + Intronic
1069892534 10:71661297-71661319 TCCCTTTTTAGGTGGGTGGGTGG - Intronic
1069941111 10:71955945-71955967 TTCTTTTTTTTGTGTGTGGGTGG + Intergenic
1070399495 10:76040766-76040788 TTCCTTTTGGGGTGTGTGGGGGG + Intronic
1070500764 10:77070679-77070701 TTACTTTTGTTGGGGGTGGGGGG - Intronic
1072446081 10:95499954-95499976 TTCCTTTTGATGGCTGAGAGCGG - Intronic
1072615618 10:97047477-97047499 CTGCTTTTGATGGGTGAGGGGGG + Intronic
1073622355 10:105062496-105062518 TAACTTTTGGTGTTTGTGGGAGG + Intronic
1073799516 10:107026064-107026086 TTCCTTTTGATGTGTGTGGGGGG - Intronic
1074373372 10:112918836-112918858 TTCCTCTTGCTTTGTTTGGGAGG + Intergenic
1075662021 10:124204358-124204380 TTCCTTTTGATATTTTTTGGGGG + Intergenic
1078325635 11:10378654-10378676 TTGCCTTTGCTGTGTGTGGCAGG - Intronic
1078610845 11:12818086-12818108 TTACTTTTCATATATGTGGGTGG + Intronic
1078743785 11:14091905-14091927 TTCCTTTTGCTGGGGGTGGCGGG + Intronic
1079670791 11:23168324-23168346 ATTCTTTAGAGGTGTGTGGGGGG + Intergenic
1080069322 11:28060448-28060470 TTCCTTTTGGTGGGGGTGGCTGG + Intronic
1080382649 11:31790235-31790257 TTCCTTTGGATTGGGGTGGGGGG - Intronic
1081828998 11:46090090-46090112 TTCCTTTTGTTGGATGTGGTTGG - Intronic
1082805851 11:57449601-57449623 TTCTTTTTGATGGCTGTAGGTGG + Intergenic
1083142145 11:60730739-60730761 TTGATTTTGATTTGTTTGGGAGG - Intronic
1083443376 11:62691231-62691253 GTCCCTTTGATCTTTGTGGGTGG - Intronic
1084426541 11:69087196-69087218 CTCCTGTTCAGGTGTGTGGGTGG + Exonic
1084897340 11:72283008-72283030 TTTTTTTTTGTGTGTGTGGGGGG + Intergenic
1086008066 11:82063986-82064008 TTCATTTTTGTGTGTGTGTGTGG + Intergenic
1086044248 11:82513957-82513979 TTGCTTTTGATGTTAGTGTGAGG + Intergenic
1086951202 11:92891813-92891835 TTCCATTTGGTGGGTGGGGGAGG + Exonic
1086973697 11:93109902-93109924 TTTCTTTTGTGGTGTGTGTGTGG - Intergenic
1088106384 11:106211215-106211237 ATCTTTTTGATGTTTGTGGAGGG + Intergenic
1089015893 11:115165009-115165031 TTTGTTTTGGTGTGTGTGGGAGG - Intergenic
1089164011 11:116460887-116460909 TTCCTTTTGCAGGGGGTGGGGGG + Intergenic
1089306882 11:117532048-117532070 TTGCTTTTGCTGGGGGTGGGGGG - Intronic
1089659383 11:119976076-119976098 TTCCCTCTGATGTGTGTGCAGGG + Intergenic
1089741507 11:120587838-120587860 TGCCTTTTGAATTGGGTGGGAGG + Intronic
1090406264 11:126477351-126477373 TCCCTTTCCCTGTGTGTGGGAGG + Intronic
1090637126 11:128696173-128696195 TTCCTTTTTTTGTGGGTGGTAGG + Intronic
1091275707 11:134348155-134348177 TTCCCTTTGATTTATGTGTGTGG - Intronic
1092602299 12:10080312-10080334 TTCCTTTTTTTGGGGGTGGGGGG - Intronic
1093017145 12:14165975-14165997 TTCCTTTTGCTGTCTTTGGTAGG - Intergenic
1094504702 12:31051852-31051874 TTCCACGTGGTGTGTGTGGGGGG - Intergenic
1096425573 12:51499346-51499368 ATCTTTTTCACGTGTGTGGGGGG - Intronic
1096548532 12:52357233-52357255 TTCCTTTTGATGGTGGTGGAGGG + Intergenic
1098922528 12:76315576-76315598 TATCTTATGATGTGTGTGGGGGG - Intergenic
1098968775 12:76825835-76825857 TTTCTTTTGGTGTGTGTGACAGG + Intronic
1100057229 12:90526777-90526799 CTCCCTTTGATATTTGTGGGTGG + Intergenic
1101599648 12:106197925-106197947 AGCCTTTTAATGTGGGTGGGGGG - Intergenic
1101939112 12:109086113-109086135 GTCCTGTTCATGTGTGTAGGTGG + Exonic
1101944375 12:109125106-109125128 GTCCTTTTTTTGTGTGTGGGCGG + Intronic
1102431171 12:112883902-112883924 TTACTGTTGATGTATTTGGGTGG + Intronic
1102431256 12:112885108-112885130 TTACTGTTGATGTATTTGGGTGG + Intronic
1102577154 12:113863041-113863063 TTTCTTTTGAGGTGTGTGGTGGG + Intronic
1102619575 12:114183293-114183315 TACCTTTTGTTGGGGGTGGGGGG - Intergenic
1103141216 12:118550011-118550033 TCCCTTTTTCTGTCTGTGGGTGG + Intergenic
1104354306 12:128071691-128071713 TTCCTTGTGATTTTTTTGGGGGG - Intergenic
1104599847 12:130145323-130145345 TTCGTTTTGCTGTGTGGGGCAGG - Intergenic
1105392412 13:19992688-19992710 TTCCTGTTCAGATGTGTGGGAGG + Intronic
1106002682 13:25738989-25739011 ATCTTGTTGATGAGTGTGGGTGG + Intronic
1106459669 13:29957987-29958009 TTCCTGTGGAAGTGTGTGAGAGG + Intergenic
1106741304 13:32645963-32645985 TTCACTTTGATGTGTGTGTGTGG + Intronic
1107242063 13:38248128-38248150 TTCCTTTTTATGTGTCTTGATGG - Intergenic
1107595545 13:41960105-41960127 TTCTTTTTCTTGTGTGTTGGTGG - Intronic
1107633642 13:42369521-42369543 TTCTTTTTGATGATTGTGGTAGG + Intergenic
1108699200 13:52929331-52929353 TTCCTTCTGATGGGTTTGGAAGG + Intergenic
1109103072 13:58211303-58211325 TTACTTTTTATGGGTGTCGGCGG - Intergenic
1109370843 13:61417115-61417137 TTCCTTTGAGTGTGTGTGTGGGG - Intronic
1109672572 13:65628402-65628424 TTCCTTCTTATTTGTGTGTGTGG - Intergenic
1110295122 13:73855419-73855441 TTCGTTTTTGTGTGTGTGTGTGG + Intronic
1111656142 13:91155924-91155946 TTCCTTTTCCTGTGTGTCAGTGG - Intergenic
1113371444 13:109728894-109728916 TTGCTTTTGAGGTGTCTGTGAGG + Intergenic
1113430391 13:110245373-110245395 TTCCTTTTGGTATCTGTAGGAGG - Intronic
1113738231 13:112693024-112693046 CTCCTTCTGATGTGTGAGGGTGG + Intronic
1118023826 14:61748179-61748201 TTCCTTTTGCTCTTTGTGGTTGG + Exonic
1119054354 14:71403991-71404013 TTCACTGTGATGTGGGTGGGTGG - Intronic
1119456719 14:74762478-74762500 TTCTTTTGGGTGTGTGGGGGGGG - Intergenic
1120041989 14:79764151-79764173 TTTCTTTTGGTGGGTGGGGGGGG + Intronic
1120728671 14:87977271-87977293 TTACTTTTAATTTTTGTGGGTGG - Intronic
1121117797 14:91355726-91355748 TTCTGTCTGATGGGTGTGGGGGG + Intronic
1121454379 14:94028918-94028940 TTCCTTTTGGCGGGTGCGGGGGG + Intronic
1121883851 14:97524849-97524871 TTCCTTTTTTTGTGTGTGTGTGG + Intergenic
1122280215 14:100617792-100617814 TTCCCCTTGGTGTGCGTGGGAGG + Intergenic
1123173899 14:106399712-106399734 TTTATTTTGATGTTGGTGGGGGG - Intergenic
1123182152 14:106480986-106481008 TTTATTTTGATGTTGGTGGGGGG - Intergenic
1202847734 14_GL000009v2_random:196016-196038 TTCTTTTTTTTGTGTGTGTGTGG - Intergenic
1202944753 14_KI270726v1_random:15744-15766 TTTATTTTGATGTTGGTGGGGGG + Intergenic
1123764049 15:23457157-23457179 TTCCTTTTAAACTGTGTTGGTGG + Intergenic
1124932504 15:34135506-34135528 TTACTTTTTGTGTGTGTGCGTGG - Intergenic
1125262738 15:37846404-37846426 TTCCTTAAAATGTGTGTGGATGG + Intergenic
1125706695 15:41743661-41743683 TTCCTTTTGTGGGGTGTGGGGGG + Intronic
1126144849 15:45464721-45464743 TTCCTTTGTGTGTGTGTGGGCGG + Intergenic
1126220892 15:46211608-46211630 TACCTTGTGGTGTGTGTGTGTGG + Intergenic
1126604792 15:50465324-50465346 CCTCTTTTTATGTGTGTGGGTGG + Intronic
1130958134 15:88641465-88641487 TTCCTTTTGAGGGTTGTGAGTGG + Intronic
1131448561 15:92519810-92519832 TGCCTCTTGATGGGGGTGGGTGG - Intergenic
1132045408 15:98559159-98559181 ATCCTTTTTATGTTTATGGGGGG + Intergenic
1132071219 15:98777969-98777991 TTGTTTTTGATGTGTGTACGGGG + Intronic
1132283540 15:100642091-100642113 TTCCTTTAAATGTGTGTTGTTGG - Intronic
1133080084 16:3311696-3311718 TTACTTTTGGTTTGTGGGGGTGG - Intronic
1133314247 16:4872441-4872463 TTTTTTTTTGTGTGTGTGGGGGG + Intronic
1134649255 16:15895608-15895630 TTCTTTTTTTTGTGTGTGTGAGG - Intergenic
1135317546 16:21462506-21462528 TTCCTTTTGGTGGTGGTGGGGGG - Intergenic
1135370440 16:21894310-21894332 TTCCTTTTGGTGGTGGTGGGGGG - Intergenic
1135383027 16:22009129-22009151 TTCCCTTTGAAGTGTGTATGTGG + Intronic
1135441347 16:22476393-22476415 TTCCTTTTGGTGGTGGTGGGGGG + Intergenic
1138183301 16:54957720-54957742 TTCCTTTGTGTGTGTGTTGGAGG + Intergenic
1138608747 16:58106222-58106244 TTCCTTCTTAAGTGTGTGGGTGG - Intergenic
1138773935 16:59697491-59697513 TTCTTTCTTGTGTGTGTGGGGGG - Intergenic
1139231804 16:65290608-65290630 TTCCTCTTCTTGTGTGTGTGTGG - Intergenic
1139331213 16:66192609-66192631 TTTTTTTTTATGTGTGTGTGGGG - Intergenic
1139640247 16:68286416-68286438 TTTCTTTTTATGTGTGTGTACGG + Intronic
1140580586 16:76226690-76226712 ATTCTTTTGAAGTGGGTGGGAGG + Intergenic
1141140802 16:81495648-81495670 TCTCTTTTTATGTTTGTGGGAGG + Intronic
1142021499 16:87785662-87785684 TTCTTTTTGGTGGGTGGGGGGGG + Intergenic
1142502378 17:340209-340231 TTGATTTTGAGGTGTTTGGGTGG - Intronic
1142621762 17:1169786-1169808 TTCCTTTTGAAATGTGGAGGTGG + Intronic
1143289756 17:5819957-5819979 TTCCTTCTGAGGTGTCTGGGTGG - Intronic
1145977054 17:28990077-28990099 TTCTTTTTTTTGTGTGTGTGTGG - Intronic
1146031107 17:29366802-29366824 TTCTTTTTGGGGTGTGTAGGGGG + Intergenic
1146781410 17:35676827-35676849 TGCCTTTTGTTGTTTTTGGGGGG + Intronic
1147530585 17:41272963-41272985 TTCCTTTTTATTTTTGTGGTGGG - Intergenic
1148350289 17:46936547-46936569 TTCCTTTTGAATGGTGTAGGTGG - Intronic
1150672706 17:67215645-67215667 GTCCTTTTGAAGTTTGTGTGAGG - Intronic
1151692013 17:75692370-75692392 TTCCTGCTGATGAGTGAGGGAGG - Intronic
1152591840 17:81217403-81217425 TTCCTCCTGGTGTTTGTGGGTGG - Intronic
1152896004 17:82911747-82911769 TTCCTTTTCAGGGGTCTGGGAGG + Exonic
1155378412 18:25188423-25188445 TTTCCTTTGATGTGTGTGAACGG + Intronic
1156501241 18:37560006-37560028 TTCATTTTGTTGTGTTTGAGAGG + Intronic
1157779852 18:50428598-50428620 TTCCTTGTAATTTGTGAGGGAGG + Intergenic
1158548299 18:58414339-58414361 TTCCTTTTGATGTGAGCTGGAGG - Intergenic
1158915641 18:62124751-62124773 TTCCTTTCAATGTGTGTGCATGG + Intronic
1159377565 18:67613665-67613687 CTCCATATGATGTGTGTGGTAGG + Intergenic
1159505728 18:69332899-69332921 TTCCTTTAGATGTATGTGTTGGG + Intergenic
1160118603 18:76106536-76106558 TTCCATTTTGTGTGTGTGTGTGG + Intergenic
1161419514 19:4168735-4168757 TTCCTTTTTGTGTGTGTGGAAGG + Intronic
1161443686 19:4306119-4306141 TTGCTGTTGATGCCTGTGGGAGG + Intronic
1161880210 19:6944810-6944832 TTCCTTTTGCTATGTGTTAGGGG + Intergenic
1162202853 19:9033716-9033738 TTTCTTTTTATGTGTGTGTGTGG - Intergenic
1162915114 19:13870509-13870531 TTCCTGGTGCTATGTGTGGGGGG + Intronic
1163241916 19:16069607-16069629 TTTCTGTTGCTGTGTGTGTGTGG + Intronic
1163460440 19:17434203-17434225 TTTATTTTTGTGTGTGTGGGAGG + Intergenic
1163968882 19:20773504-20773526 CCCCATTTGATGTGTGTGTGTGG + Intronic
1164563416 19:29309438-29309460 TTCCTTTTTATCTGTCTGAGAGG - Intergenic
1165745754 19:38228929-38228951 TCCCGTTTGATGTGTATGCGCGG + Intronic
1166623396 19:44326377-44326399 TCCCTTTTTTTGTGTGTGAGTGG + Intergenic
1167256775 19:48435178-48435200 CTCCTTTTGAGGGCTGTGGGAGG + Intronic
1167718574 19:51161100-51161122 TGCTTTTGGATGTGTGTGGAAGG + Intergenic
1168504996 19:56926388-56926410 TTTATTTTCGTGTGTGTGGGCGG + Intergenic
1202675090 1_KI270710v1_random:36161-36183 TTTCTTTTTGTGTGTGTGTGTGG - Intergenic
925389684 2:3486665-3486687 TTCCTCCTGACATGTGTGGGGGG - Intergenic
925572317 2:5325404-5325426 TTCATTTTGTTGTCTGTAGGAGG + Intergenic
926369072 2:12162299-12162321 GTCTTTGTGTTGTGTGTGGGGGG - Intergenic
927750150 2:25661724-25661746 TTTCATTTGATGTGTGTGATGGG - Intronic
928986636 2:37188731-37188753 TTCTTTTTCATGTGACTGGGAGG - Intronic
931431100 2:62209637-62209659 TCACTCTTGGTGTGTGTGGGGGG - Intronic
931987009 2:67751790-67751812 TCCCGTTTTATGTGTGTGTGTGG - Intergenic
932422965 2:71612238-71612260 GTGCTTTTGGGGTGTGTGGGGGG + Intronic
933173528 2:79152273-79152295 CTGCTTTAGCTGTGTGTGGGAGG + Intergenic
934904822 2:98190202-98190224 TGTGTTTTGATGTGTGTGTGTGG + Intronic
935975327 2:108572692-108572714 TTGCTCTTGATGTGTATAGGAGG + Intronic
936889827 2:117356254-117356276 ATCCTTTAGATGTGTTTGGAGGG - Intergenic
938424314 2:131171888-131171910 TTATTTTTGGTGTGTGTGTGTGG + Intronic
938630716 2:133164206-133164228 TTTCTTTTTGTGTGTGTGGATGG - Intronic
938836551 2:135109316-135109338 TTCTTTATTATGTGTGTGTGTGG + Intronic
939420203 2:141957367-141957389 TTCGTGTTTGTGTGTGTGGGGGG + Intronic
939619559 2:144401726-144401748 TAACTTTTGTTGTGTGGGGGTGG - Intronic
939998189 2:148939922-148939944 CTGCTTTTGGTGTGTGTGCGAGG - Intronic
940005096 2:149003086-149003108 GTGCATTTGATGCGTGTGGGTGG - Intronic
940532834 2:154902286-154902308 TTCTTTTTTGTGTGTGTGTGTGG + Intergenic
940698968 2:157017759-157017781 TTCCTGATGATGGGTGTGGGGGG + Intergenic
941653495 2:168118740-168118762 TTCCTTTTGCTCTGTGTCTGTGG - Intronic
944772639 2:202930024-202930046 TTTCATTCAATGTGTGTGGGGGG + Intronic
946321853 2:218959269-218959291 TGCCTTTGAATTTGTGTGGGGGG - Intergenic
946345273 2:219104703-219104725 TTCTTTTTTGTGTGTGTGGGGGG - Intronic
1168735209 20:129489-129511 TTCCTTTTCATGAGCATGGGAGG + Intergenic
1168995439 20:2129501-2129523 TTCCTTTTTATTGGTGGGGGAGG - Intronic
1169379603 20:5095296-5095318 TTTCTTTCGATTTCTGTGGGAGG - Intronic
1169592536 20:7161492-7161514 TTTCTTTGGATGTGTTTGTGGGG - Intergenic
1170299065 20:14861665-14861687 TTCCTGGGGTTGTGTGTGGGAGG - Intronic
1170776359 20:19378092-19378114 TCCCTTCAGATCTGTGTGGGTGG + Intronic
1171023511 20:21608242-21608264 TTCCTGTTGCTGTGTGAGTGCGG + Intergenic
1171454510 20:25260009-25260031 TGGGTTTGGATGTGTGTGGGAGG + Intronic
1173464002 20:43267055-43267077 TTCCTTTTGAAATGAGTGGCTGG + Intergenic
1174055730 20:47796951-47796973 TTCCCTTTGATTGGTTTGGGTGG + Intergenic
1174192541 20:48750485-48750507 TTTATATTGAGGTGTGTGGGAGG - Intronic
1174330190 20:49811933-49811955 TCCCCTCTGAAGTGTGTGGGAGG - Intergenic
1174523695 20:51154880-51154902 TTTGTTTTGGTGTGTGTGTGGGG + Intergenic
1174915539 20:54649446-54649468 TTGTTTTGAATGTGTGTGGGTGG + Intronic
1175009501 20:55720868-55720890 TTCCTTTTGAAGTCAGTTGGGGG - Intergenic
1175478802 20:59296854-59296876 TTCCTGCTGCTGTGGGTGGGTGG + Intergenic
1175820204 20:61904871-61904893 TCCCTTATGATGTCAGTGGGCGG - Intronic
1176014500 20:62922997-62923019 TTCTTTTTGTTGGGGGTGGGGGG + Intronic
1177887814 21:26766862-26766884 TTGCTTTTGTTTTGTGTTGGTGG - Intergenic
1178402685 21:32300220-32300242 TTACTTTTTCTGTGTGTGTGTGG - Intronic
1181572403 22:23774722-23774744 TGCCTTCTGATGTCGGTGGGAGG - Intronic
1181788667 22:25246102-25246124 CTCCTCTTGATGTGTGGTGGGGG + Intergenic
1181820355 22:25470802-25470824 CTCCTCTTGATGTGTGGTGGGGG + Intergenic
1182259259 22:29061263-29061285 TTTCTTTTTTTGTGTGTGGGGGG + Intronic
1182737542 22:32541703-32541725 TCCACTTTGATCTGTGTGGGAGG + Exonic
1183121579 22:35734109-35734131 TTAATTTTGATGTGTGTGTGTGG - Intergenic
1184023518 22:41836815-41836837 TTCCTTTGTATGTGTATGGTGGG + Intronic
949096091 3:87570-87592 TTCCTTTTTGTGTGTGTGGGGGG + Intergenic
949221575 3:1640176-1640198 TTCATTTTTGTGTGTGTGTGGGG - Intergenic
950613060 3:14138471-14138493 TTCCCATAGATGTGAGTGGGTGG + Intronic
950615547 3:14155121-14155143 TTCTGTTTGATGTCGGTGGGGGG - Intronic
951694507 3:25431711-25431733 TTCCTTTTGATGTGTTGAGTAGG - Intronic
951808528 3:26674213-26674235 ATCCTTCTGAAGTCTGTGGGAGG + Intronic
952848685 3:37710404-37710426 TCTCTATTTATGTGTGTGGGGGG - Intronic
955082958 3:55674844-55674866 TTCTTTTAGGTTTGTGTGGGTGG - Intronic
955287533 3:57657628-57657650 TTCCTTTTGCTTTGTGGTGGTGG - Intronic
955985070 3:64564604-64564626 TTCTTTTTTGTGTGTGGGGGGGG + Intronic
957104170 3:75865772-75865794 TTCTTTTGGATATGTGTGTGAGG - Intergenic
957244945 3:77704677-77704699 TTCATTTGGATATGTATGGGGGG + Intergenic
957617632 3:82551709-82551731 TATCTTTTGTTGTGTATGGGTGG + Intergenic
958602894 3:96321531-96321553 TTCCTTATGATGTCTTTTGGGGG - Intergenic
959085315 3:101846405-101846427 CTGTTTTTGATGTGTATGGGAGG + Intronic
960195737 3:114765511-114765533 TTCCTTATGAGGGTTGTGGGAGG - Intronic
960544359 3:118895487-118895509 TTTGTTTTTATGTGTGTGTGTGG - Intergenic
960781438 3:121322660-121322682 TTTCTTTTTGTGTGTGTGTGTGG + Intronic
961147405 3:124605912-124605934 TACATTTTGATGTGTGTGTTGGG - Intronic
962608979 3:137057077-137057099 TTCCTTCTGAAGTCTGTGCGGGG - Intergenic
964843041 3:161015127-161015149 ATGCTTTTGATGTGTGTGAGTGG - Intronic
965798991 3:172471812-172471834 TTCTTTTTTTTGTGTGTGTGTGG - Intergenic
966965114 3:184983786-184983808 TTGCTTTGTATGTGTGTGGGAGG - Intronic
967569951 3:191016561-191016583 TGTCTTTTGATCTGTTTGGGAGG - Intergenic
967884448 3:194323564-194323586 TTGTTTTTGCTGTGTGTGGGGGG - Intergenic
969502215 4:7559985-7560007 GTCCTTTAGATGTGTGCCGGTGG + Intronic
970968671 4:21956383-21956405 TTTCTTTTGATGTGTATATGTGG - Intergenic
971712997 4:30141312-30141334 TTTCATTTGTTGTGTGTGTGGGG + Intergenic
972284678 4:37636857-37636879 TTCTTTTTTAAGTGTGTAGGTGG - Intronic
974118995 4:57615026-57615048 TTCCTTTTGGTGTGGGTGTGGGG + Intergenic
974164487 4:58184129-58184151 TGTCTTTGTATGTGTGTGGGGGG + Intergenic
974418169 4:61637765-61637787 TTCCTATTGACGTTTTTGGGGGG - Intronic
975709907 4:77150728-77150750 TTGTTTTTTTTGTGTGTGGGGGG - Intergenic
975987625 4:80217057-80217079 TTTCTTTTTGTGTGTGTGTGTGG - Intergenic
978014814 4:103729893-103729915 TATCTTTGAATGTGTGTGGGTGG - Intergenic
979407893 4:120337750-120337772 TTCCTTTTGATATGAGTGTTAGG + Intergenic
980828259 4:138097936-138097958 GTGCATTTGATGTGTGTTGGGGG - Intergenic
981002242 4:139839189-139839211 TTCCTTGTGATGAGTGGGGAGGG - Intronic
981120623 4:141046938-141046960 TTCCTTTTGGTGTGTCGGGGAGG - Intronic
981576762 4:146213677-146213699 TTGCTTTTGTTCTGTGTGTGGGG + Intergenic
982074920 4:151729768-151729790 TTCCTTGAGTTTTGTGTGGGAGG - Intronic
983104785 4:163673124-163673146 TTCAGTTTGATGTATGTGGTTGG - Intronic
983470295 4:168146745-168146767 TTCCTTCTGTAGTCTGTGGGGGG - Intronic
984782857 4:183541657-183541679 TCCCTTTTGCTGTGTGGGGCTGG + Intergenic
985012594 4:185599774-185599796 TTCCCTTTTAGGTGTGTGTGAGG - Intronic
1202751481 4_GL000008v2_random:7931-7953 TTCTTTTGGATATGTGTGTGAGG + Intergenic
1202751746 4_GL000008v2_random:12443-12465 TTTCTTTTTTTGTGTGTGTGTGG + Intergenic
985884425 5:2665688-2665710 TTCAGATTGATGTCTGTGGGGGG + Intergenic
986536802 5:8796594-8796616 TTACTTGTTATGTCTGTGGGAGG - Intergenic
986565879 5:9113456-9113478 TTCTTTTTTGTGTGTGTGGTGGG - Intronic
986897023 5:12383790-12383812 CTCCTTCTTATTTGTGTGGGTGG + Intergenic
987001685 5:13666460-13666482 TGCCTTTTGCTGTGAGTGGATGG - Intergenic
987454506 5:18126489-18126511 TCCTTTTAGATGTATGTGGGTGG + Intergenic
987681919 5:21146825-21146847 ATCCTTTTGATTTTTGTGGCTGG + Intergenic
987911359 5:24150552-24150574 TTGTTTTGCATGTGTGTGGGGGG + Intronic
988310042 5:29544492-29544514 TTCCTTTTGTTGGAGGTGGGAGG + Intergenic
988572430 5:32382332-32382354 TTCTTTTTTGTGTGTGTGAGGGG - Intronic
990923917 5:60996967-60996989 ATCCTTTTCATGTGTGTAGAAGG + Intronic
990950776 5:61296237-61296259 TTTGTTTTCATGTGTGTGTGTGG + Intergenic
991582692 5:68173239-68173261 TTCATTTTGTTGTGGGGGGGTGG + Intergenic
991607082 5:68413488-68413510 TTCCCTTGGAAGTGTATGGGTGG - Intergenic
993446602 5:88020400-88020422 TGCCTTCTGATGTGACTGGGAGG - Intergenic
994598309 5:101868011-101868033 TTCCTTCTGATGTATGTCAGAGG + Intergenic
994787677 5:104185709-104185731 TTACTCTTGGTGTGTGTTGGGGG - Intergenic
996024197 5:118625631-118625653 TGCCTTTTGATGGGTGTTTGAGG - Intergenic
996064181 5:119063874-119063896 TTCCTTGTGGTTTGAGTGGGAGG + Intronic
996582092 5:125042450-125042472 TTCCTTTTGTTATGTGTGTATGG + Intergenic
998782935 5:145678343-145678365 TTTCTTTGGATGTTTGTAGGAGG - Intronic
999538365 5:152543997-152544019 TTCATTTTGATTTTTGTGTGTGG - Intergenic
1001391932 5:171386587-171386609 TGCCTTTTTTTGTGTGTGTGTGG - Intergenic
1003429020 6:6022142-6022164 TTCCTTCTGAGGGTTGTGGGGGG - Intergenic
1003810266 6:9771838-9771860 TTGCTTTTGATTTCTGTGGCAGG - Intronic
1004734359 6:18390279-18390301 TACCTTTAGGTGTATGTGGGAGG + Intronic
1004759011 6:18645365-18645387 TTCCTCTTCTTGAGTGTGGGTGG + Intergenic
1005079133 6:21939295-21939317 GTCTTTTTTTTGTGTGTGGGGGG + Intergenic
1005439536 6:25851031-25851053 TTCCTGTTTATTTGTGTGTGTGG + Intronic
1005818039 6:29573491-29573513 TTCCCTTTGTTATGTGTGGAAGG - Intronic
1006191687 6:32213337-32213359 GTCGTTTTGATGGGGGTGGGGGG - Intronic
1006479397 6:34279744-34279766 TTCCATTTGAGCTGTGTGGGAGG - Exonic
1006731765 6:36241523-36241545 TTTCTTTTGGTGTGTGTTGGGGG + Intergenic
1007769583 6:44182334-44182356 ACCCTTTTCATGTGTGTGTGTGG - Intronic
1008140279 6:47823872-47823894 GTTCTTTTGGTGTGTGTGTGTGG + Intronic
1008222664 6:48874652-48874674 CTCCTTTTGGTCTGTGTGGTCGG + Intergenic
1008268516 6:49462260-49462282 TTGTTTTTGAGGTGTGGGGGTGG - Intronic
1008683207 6:53896327-53896349 TTGTTTTTAATGGGTGTGGGGGG + Intronic
1008830180 6:55749743-55749765 TTTATCTGGATGTGTGTGGGGGG + Intergenic
1009052397 6:58292102-58292124 TGGCTTTTGAGGTGTGTGTGTGG - Intergenic
1009238711 6:61158512-61158534 TGGCTTTTGAGGTGTGTGTGTGG + Intergenic
1009315534 6:62214504-62214526 TTACTTTTGTTATCTGTGGGAGG - Intronic
1009561658 6:65253142-65253164 TTCCTTCTGATGTGTCTGAAGGG - Intronic
1010405085 6:75495757-75495779 TTGCATTTGGTGTGTGTGAGGGG - Intergenic
1011971556 6:93230654-93230676 TTCCTGTAGATGTGTGTTGTGGG + Intergenic
1013634372 6:112015279-112015301 TTGCTTTTGTTGTGTGTGCATGG + Intergenic
1014060453 6:117065356-117065378 TTTATTTTGAAATGTGTGGGGGG - Intergenic
1014417998 6:121208094-121208116 TTTTTTTTGGTGTGTGTGTGAGG - Intronic
1014733401 6:125061601-125061623 TTCCTTTTTATTTGAGTGGTAGG + Intronic
1014860343 6:126458881-126458903 TCCCTTTTGGTCTGTGTAGGAGG + Intergenic
1016910258 6:149192032-149192054 TTCCTGTAAATGTGTGTTGGGGG + Intergenic
1017362751 6:153595275-153595297 TTCCTGTCGATGTGTGTGTTTGG + Intergenic
1019847961 7:3525413-3525435 TCCCTTTTCTTGTGTCTGGGAGG + Intronic
1020021402 7:4871675-4871697 TTTCTTTGTGTGTGTGTGGGAGG - Intronic
1020793097 7:12650690-12650712 CTCCTTGTCAAGTGTGTGGGTGG - Intronic
1021126349 7:16854548-16854570 CTCCTTTTGAAGTGTGTGATAGG + Intergenic
1021217452 7:17934429-17934451 TTCCTTTGGATGTGTCTGTGAGG + Intronic
1021599229 7:22348223-22348245 TTGTTTTTGTTGTGGGTGGGGGG - Intronic
1022831815 7:34074957-34074979 TTTGTTTTGTTGTGTTTGGGGGG + Intronic
1023532290 7:41171093-41171115 TTTCGTTTTATGTGTGTAGGGGG + Intergenic
1024108551 7:46119862-46119884 TTTCTTTTGATGTGTCTGTCTGG + Intergenic
1025237251 7:57243207-57243229 TTCCCTTTGATTGGTTTGGGTGG - Intergenic
1026100880 7:67383724-67383746 TACCTTTAGGTGTGTGTGGCTGG + Intergenic
1027302529 7:76855578-76855600 TTCCCTTTGACATGTGTGTGTGG + Intergenic
1028699636 7:93762233-93762255 TTGCTTTTGATTTCTGTGTGTGG + Intronic
1029671113 7:102031767-102031789 CTCTTTTTCATGTGTGTGGCAGG + Intronic
1029971056 7:104789826-104789848 TTCATTAAGATGTGTGTGGGAGG - Intronic
1030073580 7:105718511-105718533 TACCTTTTGGTGTGTGTGCCTGG + Intronic
1030317450 7:108130512-108130534 TCCCTGTTTATGTGTGTGTGTGG - Intergenic
1030781976 7:113611931-113611953 TTCCTTTTCATGTGTGATGTGGG - Intergenic
1030887821 7:114960492-114960514 TCCCTTTTGATATGTGTTTGCGG - Intronic
1031484213 7:122309020-122309042 TTTCTTTTGGTGTGTGATGGAGG + Intronic
1031575916 7:123415750-123415772 TTCATTTTGATATGTGTGTTTGG - Intergenic
1032566336 7:132950567-132950589 TTCCTCCTGGTGTGTGTGGATGG - Intronic
1033181550 7:139184270-139184292 ATCCTCTTGCTGTGTGTGTGTGG + Intronic
1033535876 7:142311907-142311929 TTTCTTTTGAGGGGTGTGGTGGG + Intergenic
1034176427 7:149103684-149103706 TTTCTTGTGATGAGTGTGGAAGG - Exonic
1034295263 7:149966856-149966878 TTCCTTTTTTTTTGTGTGTGTGG + Intergenic
1034295268 7:149966860-149966882 TTTTTTTTTGTGTGTGTGGGGGG + Intergenic
1034810794 7:154130086-154130108 TTTTTTTTTGTGTGTGTGGGGGG - Intronic
1036131082 8:6110576-6110598 TTACTTTTGATGAGTGCTGGAGG - Intergenic
1036431551 8:8696380-8696402 TGCCTTCTGATTTGTGTGAGAGG + Intergenic
1036948692 8:13120532-13120554 TTCCCTTCAATGTATGTGGGTGG + Intronic
1037172198 8:15906239-15906261 TTCATTTTGCTTTGTGTTGGTGG - Intergenic
1037220293 8:16511126-16511148 ATTCTTTTTATGTGTGAGGGTGG - Intronic
1038610788 8:29058576-29058598 TTCCTTTTGGTATGTGGAGGGGG - Intronic
1039564930 8:38544501-38544523 TTCCTTCTGATGATTGTGAGGGG - Intergenic
1043179291 8:77065368-77065390 TTCCTTTTGCTATGTGTTGCTGG + Intergenic
1043294545 8:78646820-78646842 TGCCTTATCATGTGTGTTGGAGG + Intergenic
1046269574 8:111876578-111876600 TTCCTTTTGATGAATTTTGGGGG + Intergenic
1046679769 8:117155764-117155786 TTCCTTCTGAGGTCTGTGAGGGG + Intronic
1047907970 8:129493165-129493187 CTCCCTTAGATGTGTGTGGGAGG + Intergenic
1048252032 8:132874559-132874581 TTTCTTTCCATGTGTGAGGGAGG + Intronic
1049631517 8:143661027-143661049 TTCCTCTTGGTGTGGGAGGGTGG - Intergenic
1049984942 9:941334-941356 TTCCATTGCATATGTGTGGGGGG - Intronic
1052456783 9:28709455-28709477 TTACTTTGGATGTATTTGGGGGG + Intergenic
1052650248 9:31292766-31292788 ATCCTTTTTCTTTGTGTGGGTGG - Intergenic
1054521368 9:66077114-66077136 TTCCTTCTGATATGATTGGGAGG - Intergenic
1055357867 9:75455992-75456014 ATCCTTTTCATTTGGGTGGGTGG - Intergenic
1055467529 9:76580202-76580224 TTCTGTTTGATGGGTGGGGGTGG - Intergenic
1055516265 9:77036690-77036712 TTCCTTGGGGTGTGTGTTGGGGG - Intergenic
1055535544 9:77239364-77239386 TTACTTTTGGTGTGTGTGGCAGG - Intronic
1056120631 9:83484421-83484443 TTTCTTTTTGTGTGTGTGGCAGG + Intronic
1058403848 9:104649120-104649142 TTGCTTTGGCTGTGTGTGTGTGG - Intergenic
1059000999 9:110348821-110348843 TTTTTTTTGGTGTGTGTGTGGGG + Intergenic
1059008456 9:110430115-110430137 TTTTTTTTGGTGTGTGTGTGTGG + Intronic
1059106795 9:111518974-111518996 TTTATTTTCATGTGTGAGGGGGG + Intergenic
1059497593 9:114722381-114722403 TTCTTTTTTATGGCTGTGGGGGG - Intergenic
1059640100 9:116208092-116208114 TTCCTGTTGGTGTTGGTGGGTGG - Intronic
1061418190 9:130459421-130459443 TTACTTTTTGTGTGTGTGTGTGG + Intronic
1062149973 9:135013079-135013101 ATCCTGCTGATGTGCGTGGGTGG - Intergenic
1203718942 Un_KI270742v1:185620-185642 TTCTTTTGGATATGTGTGTGAGG - Intergenic
1203652906 Un_KI270751v1:144772-144794 TTCTTTTTTTTGTGTGTGTGTGG - Intergenic
1203653176 Un_KI270751v1:149295-149317 TTCTTTTGGATATGTGTGTGAGG - Intergenic
1185860007 X:3569067-3569089 GTGCTTTTGATGTGTGTGGTGGG - Intergenic
1186247206 X:7626826-7626848 TTCCTATTGATCTATGTGGTAGG + Intergenic
1186526973 X:10257753-10257775 TTTCCTTTGGTGTGTGTGTGGGG - Intergenic
1189238111 X:39504194-39504216 TTACTTTTGAAGAGTGTGTGGGG - Intergenic
1190327169 X:49213730-49213752 TTCCCTTTCACGTGGGTGGGTGG - Intronic
1192555464 X:72085550-72085572 TTCCTTTTGAGCTGTAAGGGGGG + Intergenic
1193666160 X:84320384-84320406 TACCTATTTGTGTGTGTGGGAGG + Exonic
1195073078 X:101300073-101300095 TTGCTTTTGTTGTGTGTGCTTGG + Intergenic
1195331002 X:103800313-103800335 TTTCTTTTGGTGGGGGTGGGGGG + Intergenic
1195919777 X:109972062-109972084 TTGTTTTGGCTGTGTGTGGGGGG + Intergenic
1196339106 X:114575583-114575605 TTCTTTTGTGTGTGTGTGGGGGG - Intergenic
1196437772 X:115690688-115690710 TTCCTTTTGCTTTGTCTGGCTGG + Intergenic
1197802718 X:130368392-130368414 TTCTTTTGTGTGTGTGTGGGGGG - Intronic
1198034035 X:132783537-132783559 CTACTTTGGGTGTGTGTGGGTGG - Intronic
1198061470 X:133049157-133049179 TACTTTTTCATGTGTGTGGAGGG + Intronic
1199232571 X:145454665-145454687 TTCCTTTTAATGTCTGTGTCTGG - Intergenic
1200616111 Y:5381414-5381436 GTGCGTTTGATGTGTGTGGGAGG - Intronic
1201172837 Y:11285937-11285959 TTTCTTTTTGTGTGTGTGTGTGG - Intergenic
1201173096 Y:11290462-11290484 TTCTTTTGGATATGTGTGTGAGG - Intergenic
1201731538 Y:17210094-17210116 TTCCTTATGAGGTCTGTGAGGGG - Intergenic