ID: 1073799517

View in Genome Browser
Species Human (GRCh38)
Location 10:107026065-107026087
Sequence TTTCCTTTTGATGTGTGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 574
Summary {0: 1, 1: 0, 2: 7, 3: 50, 4: 516}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073799517_1073799524 -3 Left 1073799517 10:107026065-107026087 CCCCCACACACATCAAAAGGAAA 0: 1
1: 0
2: 7
3: 50
4: 516
Right 1073799524 10:107026085-107026107 AAATCACAGGCATGGAGGTAAGG No data
1073799517_1073799523 -8 Left 1073799517 10:107026065-107026087 CCCCCACACACATCAAAAGGAAA 0: 1
1: 0
2: 7
3: 50
4: 516
Right 1073799523 10:107026080-107026102 AAAGGAAATCACAGGCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073799517 Original CRISPR TTTCCTTTTGATGTGTGTGG GGG (reversed) Intronic
902196966 1:14804978-14805000 TTTCCTTTTCATGTTTGATGTGG + Intronic
902745710 1:18473010-18473032 TTTCCTAATGATCTGTGTGGTGG + Intergenic
903688276 1:25148813-25148835 TTTCTTTTTTATATGTGTGAAGG - Intergenic
905595545 1:39203547-39203569 GTTCCTTTTGTTGATTGTGGTGG - Intronic
906247058 1:44283816-44283838 CATGCTTTTGGTGTGTGTGGGGG - Intronic
908706509 1:66962528-66962550 TTCCCATTAGCTGTGTGTGGTGG + Intronic
908966910 1:69776695-69776717 TTTCATTTTGGGGTGTGTGTGGG + Intronic
909232894 1:73114881-73114903 TTCTCTTTTTATCTGTGTGGTGG - Intergenic
909928251 1:81463864-81463886 TTTTCTTTTAATGAGAGTGGTGG - Intronic
910834712 1:91497130-91497152 TTTTTTTTTGGTGTGTGTGTGGG + Intergenic
911184469 1:94889245-94889267 TTTCCTTACGATGTGTCTGAAGG + Intronic
911546810 1:99227063-99227085 TTGCATTTTGCTGTGTGTGTCGG - Intergenic
912344954 1:108955598-108955620 ATTCCTTCTGATGTGTCTGAAGG + Intronic
913322597 1:117599651-117599673 ATTCCTCATGATGTGTGTGGTGG - Intergenic
914672856 1:149885157-149885179 TTTCCATTAGATGTATGTGAAGG - Exonic
915023457 1:152804457-152804479 TTTGCATGTGATGTGTGTGAGGG + Intronic
915751084 1:158212242-158212264 TATCCTTTTGATGGCAGTGGAGG + Intergenic
916272851 1:162962553-162962575 TTTTCTATTGTTGTATGTGGAGG + Intergenic
917183503 1:172325034-172325056 TTTCTTCTTGGTGTGTGTGTGGG - Intronic
918054189 1:181004506-181004528 TGTCCTTTTGGTGTTTGTGGAGG - Intronic
918288239 1:183079954-183079976 TTTTTTTTGGATGGGTGTGGTGG + Intronic
918894336 1:190320391-190320413 TTTGCTTTTGAACTGTGTAGTGG - Intronic
920148398 1:203883163-203883185 TTCCTTTTTTATGTGTGTGTTGG + Intergenic
920647262 1:207812772-207812794 TCTCCTCCTTATGTGTGTGGGGG + Intergenic
920719477 1:208373747-208373769 TATTCTTTTTTTGTGTGTGGTGG + Intergenic
920755951 1:208732631-208732653 TTTACTTTGTATGTGTGTAGGGG - Intergenic
920922282 1:210308083-210308105 TTTCCTTTTCATGTGGTTGTTGG - Intergenic
921556619 1:216606146-216606168 TTTCACTTTTAAGTGTGTGGTGG - Intronic
922083368 1:222320401-222320423 TTTACTTTTTATGTGAGTGCTGG - Intergenic
922602634 1:226868953-226868975 TCTCCTTTTCATGTGTTTGTTGG - Intergenic
922665268 1:227463908-227463930 TTTGTTTTGGATGTGTGTGATGG + Intergenic
922939025 1:229445080-229445102 TTTTATTTTGATGGCTGTGGGGG + Intronic
923423421 1:233843669-233843691 TTTACTTTGGCTGAGTGTGGTGG - Intergenic
924026916 1:239843025-239843047 TGTCCTTATTAAGTGTGTGGTGG - Intronic
924409822 1:243792860-243792882 ATTCATTTTAATGTGTTTGGAGG - Intronic
924760234 1:246977537-246977559 TATCCTTTTGCCGGGTGTGGTGG - Intronic
1062953622 10:1525184-1525206 TTTCCTTTTTGTATGTTTGGGGG + Intronic
1063284096 10:4664040-4664062 TCTCCCTTTGATGTATTTGGAGG + Intergenic
1064191673 10:13211851-13211873 TTTCCTTTTGATGTTTGGAAAGG - Intergenic
1065105965 10:22385197-22385219 TTTCCTTTGGATGGGTGTGGGGG + Intronic
1065316797 10:24471566-24471588 TTTTTTTTTACTGTGTGTGGGGG - Intronic
1066190794 10:33053957-33053979 TTGCCTTTTGATGGTGGTGGGGG - Intergenic
1066418494 10:35242792-35242814 TTTTTTTCTGATGTTTGTGGAGG - Intergenic
1067371310 10:45685608-45685630 GTTCCTTTTTATGTTTGTGTGGG + Intergenic
1067388473 10:45840543-45840565 GTTCCTTTTTATGTTTGTGTGGG - Intronic
1067417593 10:46116416-46116438 GTTCCTTTTTATGTTTGTGTGGG + Intergenic
1067445790 10:46344036-46344058 GTTCCTTTTTATGTGTGTGTGGG + Intergenic
1067503007 10:46823304-46823326 GTTCCTTTTTATGTTTGTGTGGG + Intergenic
1067512795 10:46909710-46909732 TTTCCTGGTGATGTGAATGGGGG + Intergenic
1067591589 10:47516706-47516728 GTTCCTTTTTATGTGTGTGTGGG - Intronic
1067638704 10:48024781-48024803 GTTCCTTTTTATGTGTGTGTGGG - Intergenic
1067649450 10:48142112-48142134 TTTCCTGGTGATGTGAATGGGGG - Intergenic
1067785663 10:49244140-49244162 CTGGCTTTTCATGTGTGTGGGGG + Intergenic
1067821053 10:49530753-49530775 TTTCCTGTTGATGTCTCTGCTGG + Exonic
1067837137 10:49648494-49648516 TTTCCTGTTGCAGTTTGTGGTGG + Exonic
1068493532 10:57755276-57755298 TTTGCTTTTGATGTTTCTAGCGG + Intergenic
1068955463 10:62816155-62816177 TTTTTTCTTGGTGTGTGTGGTGG - Exonic
1069234329 10:66051023-66051045 TTTCCTTTTTATTTTTGTGGTGG + Intronic
1069297262 10:66861693-66861715 TTTGTTTTTGAGCTGTGTGGTGG + Intronic
1069461974 10:68604189-68604211 TTTACTTTGTGTGTGTGTGGTGG + Intronic
1069903269 10:71718079-71718101 TTTCCTTTTCATGAGGGTGGGGG + Intronic
1070352665 10:75608488-75608510 TTACCATTTTTTGTGTGTGGTGG - Intronic
1070399494 10:76040765-76040787 TTTCCTTTTGGGGTGTGTGGGGG + Intronic
1071310443 10:84338341-84338363 TTTCCTTTTGTTTTTTGTTGGGG - Intronic
1071507260 10:86240317-86240339 TGTCCTAGTGATGTGTGTGCTGG - Intronic
1072615617 10:97047476-97047498 TCTGCTTTTGATGGGTGAGGGGG + Intronic
1073612325 10:104956877-104956899 ATTCATTTTGGTGTCTGTGGGGG - Intronic
1073706951 10:105995025-105995047 TTTCCTCTTGTTGTGTGTAGGGG - Intergenic
1073799517 10:107026065-107026087 TTTCCTTTTGATGTGTGTGGGGG - Intronic
1074708326 10:116155921-116155943 TTTGCTTTTGGTGGGTGTGCTGG - Intronic
1075350396 10:121719383-121719405 TTTCCCTTGGCTGGGTGTGGTGG + Intergenic
1075662020 10:124204357-124204379 TTTCCTTTTGATATTTTTTGGGG + Intergenic
1075752047 10:124780796-124780818 TTTGCTTATGATGTGTGCTGTGG - Intronic
1075767099 10:124901642-124901664 TTTCCTTTTTAAGTTTATGGAGG + Intergenic
1077860051 11:6169990-6170012 TGTCCATATGATGTTTGTGGGGG - Exonic
1078140074 11:8685845-8685867 TTTCCTTGTGGTGTGAGTGTAGG + Exonic
1078743784 11:14091904-14091926 CTTCCTTTTGCTGGGGGTGGCGG + Intronic
1079346014 11:19652922-19652944 TTTCCTGTTGATGGGTGTTAAGG + Intronic
1079670790 11:23168323-23168345 TATTCTTTAGAGGTGTGTGGGGG + Intergenic
1079956138 11:26867193-26867215 TTTACTCTTGATGGGTTTGGGGG - Intergenic
1080382650 11:31790236-31790258 TTTCCTTTGGATTGGGGTGGGGG - Intronic
1080703247 11:34663888-34663910 TTTCCTTTGCATGCGTGTGATGG + Intergenic
1080836934 11:35948029-35948051 GGTCCTTTTGCTGTGTGTGTGGG + Intronic
1083134433 11:60658394-60658416 TCTCCTTTTGTTGTGTGTCCTGG + Intergenic
1083568644 11:63742639-63742661 TTTCTTTTTTTTGTGTGTGATGG - Intronic
1083735601 11:64678515-64678537 GTTCCTTTTTATGGGTGTAGGGG - Intronic
1085231521 11:74975375-74975397 TTTCATTTTAGTGTGTGTGAGGG - Intronic
1085343229 11:75747541-75747563 TTTTCTTTTTTTGTGTGTGTAGG - Intergenic
1085666426 11:78418450-78418472 TTTCCAATTCAGGTGTGTGGGGG + Intergenic
1086481116 11:87240626-87240648 TTTCTTTTTTATGTGTGAGTAGG - Intronic
1086980371 11:93190381-93190403 TATCCTTTTTTTGTGTGTGTTGG - Intronic
1087141706 11:94770436-94770458 TTTCCTTATGATGGTGGTGGGGG + Intronic
1087574332 11:99971535-99971557 TTTGTTTTTAATGTGTGTGACGG - Intronic
1087705274 11:101483169-101483191 TTTTATTTTGGTGTGTGTTGTGG - Intronic
1088106383 11:106211214-106211236 TATCTTTTTGATGTTTGTGGAGG + Intergenic
1089063833 11:115646989-115647011 TTTCCTTGGGCTGTGGGTGGGGG + Intergenic
1089164010 11:116460886-116460908 TTTCCTTTTGCAGGGGGTGGGGG + Intergenic
1089659382 11:119976075-119976097 CTTCCCTCTGATGTGTGTGCAGG + Intergenic
1089689980 11:120181105-120181127 TCTGCTCTTGATGTGTCTGGGGG + Intronic
1090160777 11:124492614-124492636 TTTCCTTTTGTTGTTTGGAGTGG - Intergenic
1092602300 12:10080313-10080335 TTTCCTTTTTTTGGGGGTGGGGG - Intronic
1093013189 12:14129717-14129739 TTTCCTTCTCTTGTGCGTGGGGG - Intergenic
1093133357 12:15418898-15418920 TTTAATTTTTATGTGTGTAGAGG - Intronic
1093322544 12:17731386-17731408 TTTCCTTTTGATGGAGGTGATGG + Intergenic
1094042950 12:26136315-26136337 TTTCATGTTGCTGTGTATGGTGG + Intronic
1094194389 12:27731273-27731295 TGTGCTTTTGATTTGTCTGGAGG + Intronic
1094310453 12:29074900-29074922 GTTAGTTTTGATGTGTCTGGGGG + Intergenic
1094353822 12:29556446-29556468 TTTTCTTTGTGTGTGTGTGGAGG - Intronic
1095375540 12:41523783-41523805 ATTCCTTTTGATCTTTGTGTGGG - Intronic
1095799219 12:46254594-46254616 TCTCCTTTTGAGGTCTGTGTAGG + Intronic
1096451659 12:51747850-51747872 TTTTTTTTTAATGTGTGTGATGG - Intronic
1096548531 12:52357232-52357254 TTTCCTTTTGATGGTGGTGGAGG + Intergenic
1097213585 12:57392190-57392212 TTTCCCTTAGCTGGGTGTGGTGG - Intronic
1098922529 12:76315577-76315599 CTATCTTATGATGTGTGTGGGGG - Intergenic
1099140495 12:78968379-78968401 TTTCCTTTTGAGGGTGGTGGGGG - Intronic
1099243153 12:80162556-80162578 GTTCCTTTTGAGGGCTGTGGGGG + Intergenic
1099564209 12:84219771-84219793 TTTCCTTTTGATATGTGAATTGG - Intergenic
1099790198 12:87324247-87324269 TTTTTTTTTTGTGTGTGTGGTGG - Intergenic
1099986262 12:89668391-89668413 TTTCTTTTTTATGTGTGTGCTGG - Intronic
1101150575 12:101878913-101878935 TTTCCTTTTTTTGGGGGTGGGGG + Intronic
1101614279 12:106320833-106320855 TTTATTTTTGAACTGTGTGGTGG + Intronic
1101642547 12:106598461-106598483 TTTTCTTTTTTTGTGTGTGTTGG - Intronic
1102259777 12:111436911-111436933 TTTCCCGTGTATGTGTGTGGCGG - Intronic
1102577153 12:113863040-113863062 ATTTCTTTTGAGGTGTGTGGTGG + Intronic
1104354307 12:128071692-128071714 TTTCCTTGTGATTTTTTTGGGGG - Intergenic
1105526235 13:21180208-21180230 TTTTTTTTTGCTGTGTATGGTGG + Intergenic
1105700471 13:22932208-22932230 TTTCCTTGTGAAATGTGTGCTGG - Intergenic
1105853240 13:24354255-24354277 TTTCCTTGTGAAATGTGTGCTGG - Intergenic
1106111833 13:26784466-26784488 ATTCCTTTTGATGTGTATCAAGG + Intergenic
1106199040 13:27520826-27520848 ATTCCTTTTTATGGCTGTGGAGG - Intergenic
1106423475 13:29603364-29603386 TTTCCTATAGCTGTGTGTGATGG - Intergenic
1106424587 13:29613814-29613836 TATTCTTTTGTTGGGTGTGGAGG - Intergenic
1106774549 13:32996239-32996261 ATTACTTTTGAACTGTGTGGTGG - Intergenic
1107108894 13:36674619-36674641 TTTGCCTTTGTGGTGTGTGGAGG + Intronic
1108230551 13:48335655-48335677 TCTTTTTTTGGTGTGTGTGGGGG + Intronic
1109917190 13:69004986-69005008 TGTACTTGTGATGTGTTTGGAGG + Intergenic
1111093791 13:83482720-83482742 TTTCCTTTTGATGTTGTTGTTGG - Intergenic
1111619674 13:90707495-90707517 TTTCCTTTTCATTTGTCTGAAGG + Intergenic
1112106543 13:96246650-96246672 TTCCTTTTTTGTGTGTGTGGAGG + Intronic
1112131871 13:96533626-96533648 TTTAATTTTCATGTGAGTGGAGG - Intronic
1112347236 13:98600336-98600358 TTGCCTTTGGGTGGGTGTGGTGG - Intergenic
1113221742 13:108112215-108112237 TTTGCTTTTGTTGTTGGTGGTGG + Intergenic
1113231765 13:108219090-108219112 TTTACTTTTCATGTCTGTGTGGG - Intronic
1113495740 13:110727168-110727190 TTTCAGTTTGATTTGTGTGAAGG + Intergenic
1113675659 13:112205244-112205266 TTTCATTTTCTTGTGTGTGTGGG + Intergenic
1114617950 14:24078139-24078161 ATTTCTTATGGTGTGTGTGGGGG - Intergenic
1114695381 14:24622874-24622896 TTTTTTTTATATGTGTGTGGGGG + Intergenic
1115993392 14:39172061-39172083 TTACTTTTTGACTTGTGTGGTGG - Intergenic
1117303341 14:54449638-54449660 TTACCATTTGATGTGTGAGTGGG + Intergenic
1117557531 14:56901351-56901373 TTTTTTTTTGGTGTGTGTGGGGG - Intergenic
1118001702 14:61528923-61528945 GTTCCTTTTGACGTGTGTACAGG + Intronic
1118223936 14:63881264-63881286 TTTCCTTTGGCTGGGTATGGTGG - Intronic
1119915316 14:78394882-78394904 TATCCTTTTGATATGTTCGGGGG + Intronic
1120041988 14:79764150-79764172 TTTTCTTTTGGTGGGTGGGGGGG + Intronic
1120067588 14:80061381-80061403 TATCCTCTAGATATGTGTGGGGG - Intergenic
1120416497 14:84225330-84225352 TTTCCTTTTTACTTCTGTGGTGG - Intergenic
1120706761 14:87753547-87753569 GTTCATTGTGATGGGTGTGGAGG - Intergenic
1120749584 14:88185781-88185803 TTTCCTCTTGGTGAGTCTGGAGG + Exonic
1121826891 14:97017468-97017490 TTCCTTTATGATGTTTGTGGTGG + Intergenic
1121841353 14:97136552-97136574 CTTCCTTTTGATGATGGTGGTGG - Intergenic
1123173900 14:106399713-106399735 TTTTATTTTGATGTTGGTGGGGG - Intergenic
1123182153 14:106480987-106481009 TTTTATTTTGATGTTGGTGGGGG - Intergenic
1202944752 14_KI270726v1_random:15743-15765 TTTTATTTTGATGTTGGTGGGGG + Intergenic
1123754070 15:23382977-23382999 TTTCATTTTGTTGTTGGTGGTGG + Intergenic
1124499339 15:30212972-30212994 ATTGCTTTCCATGTGTGTGGGGG - Intergenic
1124744240 15:32325690-32325712 ATTGCTTTCCATGTGTGTGGGGG + Intergenic
1125706694 15:41743660-41743682 GTTCCTTTTGTGGGGTGTGGGGG + Intronic
1125823998 15:42659962-42659984 TTGCCTTTTGATGGATGTGCAGG - Intronic
1126140645 15:45435295-45435317 TTTCCTTCTGCTGGGTGTGGGGG + Intronic
1126914902 15:53455664-53455686 TCTCCTTTTGTTGTCAGTGGTGG + Intergenic
1127021844 15:54756791-54756813 TATCTTTTTGATGTGCTTGGGGG - Intergenic
1127188417 15:56505398-56505420 TTTCCTAGGGATTTGTGTGGGGG - Intergenic
1127485664 15:59415403-59415425 TTTCCTTTTGCTGGGTGCGGTGG - Intronic
1128322762 15:66704249-66704271 TTGCCACTTGATGTGTGTGCTGG - Intronic
1129348989 15:74943162-74943184 AGTCCCTCTGATGTGTGTGGGGG + Intergenic
1131374224 15:91910262-91910284 ATTCATTTGGCTGTGTGTGGAGG - Intronic
1131649459 15:94382903-94382925 TTCCCTTTTGCTGTGTTTGGCGG - Intronic
1131699446 15:94918221-94918243 TTATCTTTTGAAGTGGGTGGGGG + Intergenic
1132071218 15:98777968-98777990 TTTGTTTTTGATGTGTGTACGGG + Intronic
1133181277 16:4056539-4056561 TTTACTTTGGCTGGGTGTGGTGG - Intronic
1133360331 16:5168981-5169003 TTTTCTTCTGATGTGCTTGGAGG - Intergenic
1133559583 16:6938584-6938606 TTTCCTCTGGCTATGTGTGGTGG + Intronic
1133685557 16:8162417-8162439 TTTTTTTTTGATGGGGGTGGGGG - Intergenic
1134300502 16:12986497-12986519 TTTCCTTTGGACCTGTGTGGTGG + Intronic
1135413997 16:22255284-22255306 TTTCTTTTTCACTTGTGTGGAGG + Intronic
1135613425 16:23888539-23888561 TTTCTTTTTTAAGTGTGTGCTGG + Intronic
1135880974 16:26256714-26256736 TATCCTTTTGATGTCTACGGAGG - Intergenic
1137093229 16:36220888-36220910 TTTTCTTTTTTTGTGTGTGATGG + Intergenic
1137598040 16:49737827-49737849 TTTCCTTCTGATTCGTGTGCTGG - Intronic
1138773936 16:59697492-59697514 TTTCTTTCTTGTGTGTGTGGGGG - Intergenic
1138941021 16:61789946-61789968 TTTCATTTTGTTGTTGGTGGTGG + Intronic
1139162829 16:64532524-64532546 TTAACTTTTTATGTGCGTGGGGG + Intergenic
1139331214 16:66192610-66192632 TTTTTTTTTTATGTGTGTGTGGG - Intergenic
1141056309 16:80817868-80817890 TTTCACTTTGATGTGTGCTGAGG - Intergenic
1141108384 16:81252217-81252239 TTTTCTTTTCTTGTGTGTGTGGG + Intronic
1141190534 16:81821533-81821555 TTTCCTTTTGAGGTGGGTCCTGG + Intronic
1142967988 17:3592745-3592767 TTTCCTTGTTCTGTGTGGGGAGG - Intronic
1143316608 17:6037784-6037806 TTTGCTTTTGTTGTTTTTGGAGG + Intronic
1143325409 17:6095252-6095274 TTTCCTTTAAGTGTGTGTGGTGG + Intronic
1143866443 17:9926977-9926999 TATCCTGTAGACGTGTGTGGGGG - Intronic
1143902099 17:10182161-10182183 CTTACTTTTGGTGTGTGTGACGG + Intronic
1144735030 17:17550524-17550546 TTTGGTTTTGAACTGTGTGGTGG - Intronic
1145411172 17:22666809-22666831 TTTCCTAGTTTTGTGTGTGGGGG + Intergenic
1146148352 17:30442864-30442886 TTTTGTTTGGATATGTGTGGTGG + Intronic
1146171967 17:30641360-30641382 TTTCCTGTTCCTGTGTGGGGAGG + Intergenic
1146345426 17:32057396-32057418 TTTCCTGTTCCTGTGTGGGGAGG + Intergenic
1146489184 17:33267879-33267901 ATTCCCTCTGATGTGGGTGGTGG + Intronic
1146781409 17:35676826-35676848 TTGCCTTTTGTTGTTTTTGGGGG + Intronic
1146806643 17:35870259-35870281 TTTGCTTTATCTGTGTGTGGGGG - Intergenic
1147026787 17:37593053-37593075 TTTTCTTTTTATGTGTTTTGGGG + Intronic
1147122136 17:38341828-38341850 TTTCCTTCCGCTGGGTGTGGTGG + Intronic
1147530586 17:41272964-41272986 TTTCCTTTTTATTTTTGTGGTGG - Intergenic
1148009068 17:44460672-44460694 TTTCCTTTTGATTTGAGTTTAGG - Intronic
1149636140 17:58170923-58170945 TTTCCTTTTGGTGTGAGTCTGGG + Intergenic
1149662400 17:58341530-58341552 TTTGCTTTGGCTGGGTGTGGTGG - Intergenic
1149916599 17:60615107-60615129 TTTCCTTAGGCTGGGTGTGGTGG + Intronic
1150056617 17:62022594-62022616 TTTCCTGTGGCTGGGTGTGGTGG - Intronic
1150325223 17:64251606-64251628 TTTCCTTTTGACATGTCAGGTGG + Intronic
1150821005 17:68434316-68434338 TCCCTTTTTGATGTGTGTGTGGG - Intronic
1151988806 17:77560903-77560925 TTTCCTTTTGCTGTTTGTGTGGG + Intergenic
1153138401 18:1943544-1943566 TTTCCTGATGATTTGTGAGGTGG + Intergenic
1153277316 18:3380234-3380256 TTTCTTTTGTGTGTGTGTGGTGG - Intergenic
1153686627 18:7552641-7552663 TTGATTTTTGATGTATGTGGAGG + Intergenic
1154215727 18:12414740-12414762 TTTTCTTTTGGTGGGGGTGGAGG - Intronic
1154503434 18:15008329-15008351 TTTCCTATTGATTGGTGTGTAGG - Intergenic
1156008309 18:32469860-32469882 TTTCCTTTAAATCTGTTTGGCGG + Intronic
1156898610 18:42274742-42274764 TCTCCTTCTGATGTGTCTGATGG + Intergenic
1157261933 18:46183280-46183302 ATTCCTTTGGATTTCTGTGGTGG + Intronic
1158159839 18:54468721-54468743 TTTCTATTTTTTGTGTGTGGCGG - Intergenic
1158540342 18:58347993-58348015 TCTCCTTTTTATGTTTTTGGAGG + Intronic
1158985857 18:62816050-62816072 TTTCCTTTTGTTGAATGTTGAGG + Intronic
1159096402 18:63907094-63907116 TTTCATTTGCATGTGTATGGAGG - Intronic
1159505727 18:69332898-69332920 TTTCCTTTAGATGTATGTGTTGG + Intergenic
1159858748 18:73620431-73620453 TTTGCTTTTGATGTCTCTGCTGG + Intergenic
1160139550 18:76309465-76309487 TTTCCTTTGGTTGTGTTAGGAGG - Intergenic
1161515893 19:4696271-4696293 TTTCGTTGTTCTGTGTGTGGAGG - Intronic
1161880209 19:6944809-6944831 TTTCCTTTTGCTATGTGTTAGGG + Intergenic
1162211044 19:9092427-9092449 TTATCTTTTCTTGTGTGTGGTGG - Intergenic
1162783027 19:13016958-13016980 TTTCAGTTTGCTGTGGGTGGAGG - Intronic
1162990461 19:14298672-14298694 TTTCCTGTTCCTGTGTGGGGAGG - Intergenic
1163362677 19:16857659-16857681 TCTATTTTTGATGTGGGTGGTGG - Intronic
1163537870 19:17888115-17888137 TGCCCTTTGGCTGTGTGTGGAGG + Intronic
1164486622 19:28661959-28661981 TTTCTATTTTATGTGTGTAGAGG - Intergenic
1165400654 19:35597573-35597595 TTTTGTTTTGCTGGGTGTGGTGG - Intergenic
1165767430 19:38360062-38360084 TTCCCTTCAGATGTGTATGGGGG + Intronic
1167730205 19:51248562-51248584 CTTCCTTTTGATGTTCTTGGAGG - Intronic
1168361262 19:55742577-55742599 TTTTTTTTTGCTGGGTGTGGTGG - Intergenic
925129028 2:1481501-1481523 TTTGCTTTGGATGTGTGTGGAGG + Intronic
925638113 2:5961423-5961445 TTTCCTTTTGATGTGTTGTTGGG + Intergenic
925708781 2:6716785-6716807 CTTCCTTTTTTTGTGTGTGTTGG - Intergenic
925945569 2:8859895-8859917 TTTCCTTAGGCTGGGTGTGGTGG + Intronic
926152667 2:10433631-10433653 TATGCTGTGGATGTGTGTGGTGG + Intergenic
926369073 2:12162300-12162322 TGTCTTTGTGTTGTGTGTGGGGG - Intergenic
926558605 2:14390080-14390102 TTTAGTTTTTATGTGTTTGGAGG - Intergenic
926881374 2:17548215-17548237 TTTGGATTTGATGTGTGTGGGGG - Intronic
927398223 2:22680791-22680813 GTACTTTTTGATGTGGGTGGTGG - Intergenic
927750151 2:25661725-25661747 TTTTCATTTGATGTGTGTGATGG - Intronic
927893830 2:26768928-26768950 TTTCCTTAAGCTGGGTGTGGTGG - Intronic
928772238 2:34716723-34716745 TTTCCATTTTATGTGTGTAAAGG + Intergenic
929259216 2:39845723-39845745 TTTCCTTTTCAAGTGTGTCCAGG - Intergenic
929823296 2:45290516-45290538 TTTCCATGGCATGTGTGTGGAGG - Intergenic
930240315 2:48929453-48929475 GTTTCTCTTGATGAGTGTGGTGG + Intergenic
930568638 2:53055951-53055973 TTTCTTTTTGCTGGGGGTGGTGG - Intergenic
930657760 2:54023205-54023227 TTTACATTTTATGTGTGTGTGGG + Intronic
932892605 2:75609918-75609940 TTCCCTTTGGAGGAGTGTGGAGG + Intergenic
933132883 2:78695517-78695539 TTTTGTTTTGATTTGTGTGTCGG + Intergenic
933821208 2:86113803-86113825 TTTAATTTTTTTGTGTGTGGCGG - Intronic
933848493 2:86346782-86346804 TTTTCTATCGAAGTGTGTGGGGG + Intergenic
935249541 2:101249563-101249585 TTTCCTATAGGTGTGAGTGGTGG + Intronic
935735241 2:106101334-106101356 TTTGCTTTTTTTGGGTGTGGTGG + Intronic
936665510 2:114590712-114590734 TTTCTATTTTATTTGTGTGGTGG - Intronic
936889828 2:117356255-117356277 AATCCTTTAGATGTGTTTGGAGG - Intergenic
937633709 2:124131876-124131898 TTTCATTTTGCTGTGTGTCTTGG + Intronic
937877110 2:126834079-126834101 TTTGCTGTTGATGATTGTGGTGG - Intergenic
938034541 2:128025773-128025795 TTTCCCTATGGTGTCTGTGGGGG - Intronic
938900385 2:135794482-135794504 TTTCCTTGGGATCTGTGGGGTGG + Intronic
938934177 2:136114671-136114693 TTTCATATTGATGTGTGTCTAGG - Exonic
938973174 2:136450579-136450601 TTTCCCTTGGCTGTGGGTGGTGG + Intergenic
939634857 2:144569570-144569592 TTTCCTTGGCATGTGTGTGTAGG + Intergenic
940698967 2:157017758-157017780 CTTCCTGATGATGGGTGTGGGGG + Intergenic
940860130 2:158762610-158762632 TTGCCTTTTGATGGGGGTGGTGG - Intergenic
941374581 2:164711129-164711151 TTTCCTTTTCATGAATGAGGAGG - Intronic
941601608 2:167549822-167549844 TTTCCTTTTAATGTTTGTATTGG + Intergenic
941715562 2:168759713-168759735 GTTCTTTATTATGTGTGTGGGGG + Intronic
942460368 2:176164078-176164100 GTTTCTTTTGATATCTGTGGAGG - Intronic
942728686 2:179039488-179039510 TTTTCTTTTTAGGTGTGTGAAGG + Intronic
943986705 2:194631036-194631058 TGGTCTTTGGATGTGTGTGGTGG + Intergenic
944568734 2:201020200-201020222 ATACTTTTTGATGTGGGTGGTGG - Intronic
945115696 2:206406140-206406162 TTTCCTTTGGGTGGGGGTGGGGG + Intergenic
945230895 2:207588731-207588753 TTTTTTTTTTTTGTGTGTGGGGG + Intronic
946345274 2:219104704-219104726 CTTCTTTTTTGTGTGTGTGGGGG - Intronic
947253713 2:228137800-228137822 TTTCATTTTGAACTGTGTGAAGG - Intronic
948110385 2:235450303-235450325 TTTTCTTTTGTTTTGTTTGGCGG + Intergenic
1169156029 20:3330526-3330548 TCTGCTTTTGCTGGGTGTGGTGG - Intronic
1169441623 20:5638531-5638553 TTTCATAGAGATGTGTGTGGTGG + Intergenic
1169891687 20:10460387-10460409 TTTCCTTTTGATGTTGGTTGGGG + Intronic
1171176622 20:23055105-23055127 TTTCTGCTTGATGTCTGTGGAGG + Intergenic
1172188145 20:33044293-33044315 TTTCCTTTTGGTGGGTTTTGGGG + Intergenic
1172270134 20:33650366-33650388 TTTCGTTTTGTTTTGTGGGGAGG + Intergenic
1172423829 20:34841491-34841513 TTTCCTTTTGATGGATGTTTGGG - Intergenic
1173174382 20:40753319-40753341 TTTCCTGTTCATGTGTCTGAGGG - Intergenic
1173282642 20:41643144-41643166 TTTCTGTTTAATGTGTCTGGGGG + Intergenic
1173307986 20:41869934-41869956 TTTCCTTTTGGTTTGTCTTGAGG + Intergenic
1173442627 20:43091863-43091885 TTTGCTTTTCTTGTGAGTGGAGG - Intronic
1173454758 20:43192958-43192980 TGGCCTTTTGATGTGTGTCAGGG + Intergenic
1173626672 20:44477940-44477962 TTTTCTTGGGCTGTGTGTGGTGG - Intronic
1174514860 20:51083847-51083869 ATTCCTTCTGCTGTGTGTTGAGG + Intergenic
1174523694 20:51154879-51154901 TTTTGTTTTGGTGTGTGTGTGGG + Intergenic
1175009502 20:55720869-55720891 TTTCCTTTTGAAGTCAGTTGGGG - Intergenic
1176518104 21:7801763-7801785 ATTCCTTTTTATGTGTGAAGTGG - Intergenic
1178288438 21:31345645-31345667 GTTCCTTTAGATGTGTTTGTGGG - Intronic
1178652132 21:34431776-34431798 ATTCCTTTTTATGTGTGAAGTGG - Intergenic
1179159959 21:38886783-38886805 TTTCCTTTAGATCTTTGTGGTGG - Intergenic
1179258530 21:39738543-39738565 TTTAATTTTTATGTGCGTGGAGG + Intergenic
1179611757 21:42556527-42556549 TGTATTTTTGTTGTGTGTGGGGG + Intronic
1181624058 22:24110874-24110896 TTTTTTTTAAATGTGTGTGGAGG + Intronic
1182259258 22:29061262-29061284 CTTTCTTTTTTTGTGTGTGGGGG + Intronic
1183755914 22:39764304-39764326 TTTTATTTTTGTGTGTGTGGAGG - Intronic
1184023517 22:41836814-41836836 CTTCCTTTGTATGTGTATGGTGG + Intronic
1184227213 22:43135953-43135975 CTTCCTTTAGCTGGGTGTGGTGG + Intronic
1184297330 22:43533244-43533266 TTTCCTCTGAGTGTGTGTGGTGG - Intronic
1185161323 22:49231636-49231658 TCTCCGAGTGATGTGTGTGGAGG - Intergenic
949096090 3:87569-87591 ATTCCTTTTTGTGTGTGTGGGGG + Intergenic
949221576 3:1640177-1640199 TTTCATTTTTGTGTGTGTGTGGG - Intergenic
949734176 3:7151988-7152010 TTTCCTAATGAGGTGTTTGGTGG + Intronic
950615548 3:14155122-14155144 TTTCTGTTTGATGTCGGTGGGGG - Intronic
951397728 3:22190442-22190464 GTTCCTTTTGAAGTGTCTAGAGG + Intronic
951644091 3:24867823-24867845 TTTCCTTTTGTTGTTTTTGTGGG - Intergenic
952110555 3:30119214-30119236 TTTATTTTTGAACTGTGTGGTGG - Intergenic
952335438 3:32399658-32399680 TCTGCTTTAGATGTGTATGGCGG + Intronic
952848686 3:37710405-37710427 TTCTCTATTTATGTGTGTGGGGG - Intronic
954092137 3:48293611-48293633 TTTCCTTTGGCTGGGTGAGGAGG - Exonic
954576960 3:51681648-51681670 TTTCATGTGGGTGTGTGTGGGGG + Intronic
955047959 3:55377481-55377503 TCTTCTTTTGCTGTGTTTGGTGG - Intergenic
955252704 3:57300537-57300559 TTTCCATTTGTGGTGTGTGTGGG - Intronic
955309395 3:57869444-57869466 TATATTTTTAATGTGTGTGGTGG - Intronic
955749161 3:62169832-62169854 TTCCCTTTTGTTGGGGGTGGGGG - Intronic
956021334 3:64936545-64936567 TTTCCTTTAGAAGTGTGCTGTGG - Intergenic
956820036 3:72945987-72946009 TTTCTTTTGGCTGGGTGTGGTGG + Intronic
957633103 3:82743735-82743757 CATCCTTTTGATGTCTTTGGGGG - Intergenic
958510610 3:95042540-95042562 TGTGATTTTGATGTGTTTGGTGG + Intergenic
958696665 3:97536852-97536874 TTTCGTTTTTTTGTGTGTGGTGG - Intronic
960687972 3:120313044-120313066 CTTCCTTTGGCTGGGTGTGGTGG + Intergenic
960897369 3:122519813-122519835 GTTCCCTTTGCTGGGTGTGGTGG - Intergenic
961147406 3:124605913-124605935 TTACATTTTGATGTGTGTGTTGG - Intronic
961472676 3:127126118-127126140 TGTGCTTGTGTTGTGTGTGGAGG + Intergenic
963828039 3:149976616-149976638 CTTCTTTATGATCTGTGTGGTGG + Intronic
965157093 3:165075526-165075548 TTTCCTTTGCAAGTGTGTGAAGG + Intronic
965435864 3:168650619-168650641 TTTCCCTTTGATGTGGTTGATGG + Intergenic
965933610 3:174078479-174078501 TTTCCTATTTATGTGTGTATAGG + Intronic
966648433 3:182272095-182272117 TTTTGTTTTGATGTGTGTCGGGG - Intergenic
966709065 3:182951647-182951669 TTTCTTTCTTTTGTGTGTGGTGG - Intronic
966780812 3:183582466-183582488 TTGGCTTTCGATGTGTGGGGAGG - Intergenic
966998801 3:185311849-185311871 TTTCCTTTTGATGACTGTGTAGG - Intronic
967355989 3:188572185-188572207 TTTGCTTTTTATGTATGTAGAGG + Intronic
967452084 3:189636835-189636857 TTTGATTTTGAACTGTGTGGTGG - Intronic
967464933 3:189793838-189793860 TTTTCTTTAGATGTATGTTGAGG + Intronic
967715207 3:192754446-192754468 TATCCCTTTGATGTGTTAGGAGG - Intronic
967727883 3:192879020-192879042 TTTCTTTTTGAGGAGGGTGGGGG - Intronic
967884449 3:194323565-194323587 TTTGTTTTTGCTGTGTGTGGGGG - Intergenic
967974189 3:195022669-195022691 TTACCTTTTCAAATGTGTGGTGG + Intergenic
968154138 3:196364847-196364869 TTTCCTTTGGCCGGGTGTGGTGG - Intronic
969027053 4:4181919-4181941 TTTTCTTTTTGTGTGTGTTGAGG - Intergenic
969934094 4:10664403-10664425 TTTCCTTTTGCTGTGCCTTGTGG - Intronic
974118994 4:57615025-57615047 TTTCCTTTTGGTGTGGGTGTGGG + Intergenic
974418170 4:61637766-61637788 TTTCCTATTGACGTTTTTGGGGG - Intronic
974731236 4:65868861-65868883 TTTCCTTTTTTTGTGTGTTTAGG + Intergenic
975347739 4:73312938-73312960 TTTCCATTTTATGAGTATGGTGG + Intergenic
975871284 4:78781433-78781455 TTTTTTTTTGAGGTGTTTGGAGG + Intronic
977465059 4:97373522-97373544 TCACCTTTTGGTGTGTGTGTGGG - Intronic
978368381 4:108006170-108006192 TTTCCTTAGGGAGTGTGTGGGGG + Intronic
978389729 4:108212974-108212996 TGTCCTTTAAATGTTTGTGGAGG - Intergenic
980253296 4:130346092-130346114 CTCCCTTAAGATGTGTGTGGAGG - Intergenic
980828260 4:138097937-138097959 TGTGCATTTGATGTGTGTTGGGG - Intergenic
981002243 4:139839190-139839212 GTTCCTTGTGATGAGTGGGGAGG - Intronic
981576761 4:146213676-146213698 TTTGCTTTTGTTCTGTGTGTGGG + Intergenic
981847971 4:149191379-149191401 TTTCCTTTTTATTTTTGGGGTGG - Intergenic
982166234 4:152615945-152615967 TTTCATTTTGAGGAGTGTGTTGG - Intergenic
982611499 4:157579755-157579777 TTTCCTTTTTCTTTGTTTGGTGG - Intergenic
982625897 4:157766156-157766178 TTTCTTTTTTTTGTGTGTGACGG + Intergenic
983470296 4:168146746-168146768 TTTCCTTCTGTAGTCTGTGGGGG - Intronic
983709638 4:170697727-170697749 TTTTCTGTTTATTTGTGTGGAGG + Intergenic
984342537 4:178475758-178475780 TTACCTTTTTGTGTGTGTGATGG - Intergenic
984578827 4:181486162-181486184 TTTCCTGCTGAGGTGTGTTGGGG - Intergenic
985164513 4:187078712-187078734 TTTCCTTTACCTGTCTGTGGAGG - Intergenic
985884424 5:2665687-2665709 TTTCAGATTGATGTCTGTGGGGG + Intergenic
986565880 5:9113457-9113479 TTTCTTTTTTGTGTGTGTGGTGG - Intronic
987358853 5:17088582-17088604 TTTCCTTTTGCTGGGTGTGGTGG + Intronic
987833438 5:23128872-23128894 GTTATTTTTGGTGTGTGTGGTGG - Intergenic
987911358 5:24150551-24150573 TTTGTTTTGCATGTGTGTGGGGG + Intronic
988572431 5:32382333-32382355 TTTCTTTTTTGTGTGTGTGAGGG - Intronic
988898805 5:35708723-35708745 TTGCCTTTTGATGGCAGTGGTGG - Intronic
988963328 5:36391108-36391130 TTTCCTTTGGTGGTGAGTGGAGG - Intergenic
989109680 5:37895256-37895278 TTTCCTTTTCATGTGAGTAATGG + Intergenic
990590731 5:57261048-57261070 AATCCTTTTGATGTGTCTTGGGG + Intronic
992088832 5:73300283-73300305 CTTCCCTTTGCTGTATGTGGTGG - Intergenic
992217381 5:74539291-74539313 TTGCCTTTGGCTGGGTGTGGTGG - Intergenic
993467382 5:88265732-88265754 TTTCTTTTTGAGGGGAGTGGAGG - Intronic
993769870 5:91913992-91914014 TTGGATTTTGATGTGTGTGGGGG + Intergenic
994372231 5:98980000-98980022 TTTCCTTTTCATGGTTCTGGAGG - Intergenic
994832137 5:104797811-104797833 ATTCCTTTTGAAGTGTAAGGTGG + Intergenic
996044641 5:118857211-118857233 TTTCCTATTCATGTGTGTGGGGG + Intronic
996557259 5:124791452-124791474 TTTCCTTTTTATGTTTCTAGAGG + Intergenic
997029907 5:130115195-130115217 TTTCTTTTTGAAGTGTTAGGGGG - Intronic
997914382 5:137909821-137909843 TTTCTTTTGGCTGGGTGTGGTGG - Intronic
998153503 5:139770727-139770749 TTAGCTTATGATGTGTGAGGAGG - Intergenic
998173553 5:139886419-139886441 TTTGCATTTTGTGTGTGTGGTGG + Intronic
998473558 5:142402227-142402249 CTTCCTATTGTTGTGTGAGGGGG + Intergenic
999537326 5:152531447-152531469 TTTCTTTTTATTGTGTGTTGTGG + Intergenic
1000554534 5:162709018-162709040 TTTCATTCTGATGACTGTGGCGG - Intergenic
1000954544 5:167527302-167527324 TTTTCTTTTGTGGTGGGTGGGGG - Intronic
1000996305 5:167962275-167962297 TTTCCTTTTGATGGATGTCAAGG - Intronic
1003439347 6:6124655-6124677 TTTCATATTGTTATGTGTGGAGG + Intergenic
1003775239 6:9353140-9353162 TTTCATTTTTGTGTGTGTTGTGG + Intergenic
1003864888 6:10353792-10353814 TTTCCATTAGTTGTGCGTGGTGG + Intergenic
1003887186 6:10532378-10532400 TTTCTGTGTTATGTGTGTGGAGG + Intronic
1004404872 6:15323636-15323658 ATTCCTTTTGTTGGGTGTGGTGG + Intronic
1004414666 6:15414733-15414755 TTTTCTTTTGATCATTGTGGTGG + Intronic
1004741976 6:18471168-18471190 TTTCCTTTTGTGGGGAGTGGAGG + Intergenic
1004786830 6:18977208-18977230 TCTCCTTTTGGTGTGTGTGATGG - Intergenic
1005079132 6:21939294-21939316 TGTCTTTTTTTTGTGTGTGGGGG + Intergenic
1005757193 6:28935425-28935447 TTTCCTCTTGATCTGGATGGTGG - Intergenic
1005969692 6:30751445-30751467 TTTTTTTTTGCTGGGTGTGGTGG - Intergenic
1006191688 6:32213338-32213360 TGTCGTTTTGATGGGGGTGGGGG - Intronic
1006207857 6:32365347-32365369 TTTCCTTTTGTTGTCCATGGTGG + Intronic
1006731764 6:36241522-36241544 GTTTCTTTTGGTGTGTGTTGGGG + Intergenic
1007600521 6:43077917-43077939 TTTTCTTGTGATGTGTGTGGTGG + Intronic
1008170846 6:48203569-48203591 TTTCCTTTTCATGTCTTTGAGGG + Intergenic
1008373292 6:50761215-50761237 TTTTTTTTTGGTGTGTGTGAAGG - Intronic
1008474414 6:51920892-51920914 TTTCCATTTTATTTGTGTAGAGG + Intronic
1009507283 6:64500594-64500616 TTTCCTTTTGATATGCATGTTGG - Intronic
1009561659 6:65253143-65253165 CTTCCTTCTGATGTGTCTGAAGG - Intronic
1009564645 6:65297786-65297808 TTTTCTTTTTCTGTATGTGGAGG - Intronic
1009894810 6:69734978-69735000 TTTGTTTTTGAACTGTGTGGTGG - Intronic
1009936009 6:70235164-70235186 TTTCTTTTGGCTGGGTGTGGTGG + Intronic
1010744967 6:79550504-79550526 TTTCGTTTTAATCTCTGTGGTGG - Intergenic
1011756931 6:90509340-90509362 TTGTCTTTTTTTGTGTGTGGGGG + Intergenic
1011806547 6:91079167-91079189 TTTATTTTTGATGGGTTTGGAGG + Intergenic
1011971555 6:93230653-93230675 TTTCCTGTAGATGTGTGTTGTGG + Intergenic
1012257877 6:97055212-97055234 TTTCCTTATGATATGTGTACTGG - Intronic
1013726793 6:113107908-113107930 TTTTCTTTTTGTGTGTGTGGTGG + Intergenic
1014203453 6:118629437-118629459 TTTCCTGATGATGTATGAGGTGG - Intronic
1014236701 6:118965213-118965235 TTTTTTTTTGGTGTGTGTAGAGG + Intronic
1014395119 6:120918153-120918175 TTTCATTATGATGTGTTTGTGGG - Intergenic
1015665481 6:135623571-135623593 TTTTCTTTAGCTGGGTGTGGCGG - Intergenic
1016131541 6:140478746-140478768 GTTCCTTTTGATGGCTGTGAGGG + Intergenic
1016175942 6:141077734-141077756 TTCCCTTGTGATCTGTGTGACGG + Intergenic
1016662633 6:146599045-146599067 TTTCTTTTTGGTTTGTTTGGAGG - Exonic
1017156206 6:151324620-151324642 TTTCCTTTTTGTTTGTGTAGGGG + Intronic
1017256070 6:152335028-152335050 TTTCTTTTTGCTGTGTATGCAGG - Intronic
1017339410 6:153303028-153303050 TATCATTTTTTTGTGTGTGGTGG + Intergenic
1018143220 6:160860389-160860411 TTTTCTTTTTGTGTGTGTGATGG + Intergenic
1018570917 6:165208879-165208901 TTAGCTTTTGAACTGTGTGGTGG + Intergenic
1018930682 6:168238188-168238210 TTTCCCTTTGACCTGTTTGGGGG + Intergenic
1019732619 7:2636234-2636256 TTTCCTTCTGATGAGTGGGGAGG - Intronic
1020576187 7:9931913-9931935 TTTTCTTTTGTTGCTTGTGGTGG + Intergenic
1020671468 7:11120450-11120472 TTTTCATTTGATGTGTGTGAAGG - Intronic
1020801745 7:12740809-12740831 TTTCCTTATCATTTGTGAGGCGG + Intergenic
1021540689 7:21754414-21754436 TTTCCTTTGGGTCTGTGTGTAGG + Intronic
1021548368 7:21841859-21841881 ATTGCTTTTGAACTGTGTGGTGG + Intronic
1022831814 7:34074956-34074978 TTTTGTTTTGTTGTGTTTGGGGG + Intronic
1023022611 7:36023840-36023862 TTTTTTTTTGATGTTTGAGGCGG + Intergenic
1023728119 7:43164679-43164701 TTTCCTTTTGGTGTGGAGGGAGG + Intronic
1023869647 7:44256172-44256194 TTTCCTTGTGGTCGGTGTGGTGG - Intronic
1024052573 7:45637433-45637455 TTTCTTTTGGCTGGGTGTGGTGG + Intronic
1024740588 7:52349799-52349821 TTTTATTTTTATGTGTGTGCAGG - Intergenic
1026050394 7:66941761-66941783 TTTCCTTTTGAGGTGTTGGGGGG - Intronic
1027253155 7:76411903-76411925 TTTCCTTTAGCTGGGTGAGGTGG + Intronic
1028120772 7:87054450-87054472 TTTCCTGTTAATGCCTGTGGAGG - Intronic
1028197001 7:87919067-87919089 TTTCTCTGAGATGTGTGTGGGGG - Intergenic
1029033548 7:97494251-97494273 ATTCACTTTGTTGTGTGTGGGGG + Intergenic
1029315704 7:99711368-99711390 TTTCCTTTAGATATGTTTGAGGG + Intronic
1030239330 7:107303726-107303748 TTACCTTTGGCTGGGTGTGGTGG - Intronic
1030781977 7:113611932-113611954 GTTCCTTTTCATGTGTGATGTGG - Intergenic
1030909184 7:115225550-115225572 TTTCTTTTTGATGTCTGTCATGG - Intergenic
1031156389 7:118116499-118116521 TTTCCTTTCCATGGGTGTTGGGG - Intergenic
1032516531 7:132510201-132510223 TCTACTTTTGAGGTGTTTGGGGG - Intronic
1032932239 7:136686618-136686640 TTTCATTTTGCTGTGGGAGGAGG - Intergenic
1033535875 7:142311906-142311928 TTTTCTTTTGAGGGGTGTGGTGG + Intergenic
1034810795 7:154130087-154130109 TTTTTTTTTTGTGTGTGTGGGGG - Intronic
1034880759 7:154760745-154760767 TTTCCTCTTCATTTGTGTTGTGG - Intronic
1035350212 7:158240158-158240180 TATCTTTTTGATAAGTGTGGAGG + Intronic
1035930110 8:3771047-3771069 TTTCATTTGCATGTCTGTGGTGG + Intronic
1036581495 8:10079632-10079654 TTTCCTTATGTTGTGCGGGGAGG - Intronic
1037014513 8:13886111-13886133 CTTCCTTTGGCTGGGTGTGGTGG + Intergenic
1037476781 8:19265469-19265491 TTTCCTCTTGAAGGGCGTGGAGG + Intergenic
1038861988 8:31397647-31397669 TTGCCGTGTGCTGTGTGTGGTGG + Intergenic
1039088724 8:33805638-33805660 TTGCATTTTGATGGGGGTGGGGG + Intergenic
1039597106 8:38799878-38799900 TGTACTTTGGATGTGTGTGCTGG + Intronic
1039724319 8:40198954-40198976 TTTCTTTTTGATTAGTGTGTTGG - Intergenic
1040326960 8:46351367-46351389 TTTCCGGTTTATGTGTGTAGAGG + Intergenic
1040761161 8:50845914-50845936 TTTCCATTTAATATGTGTGCAGG - Intergenic
1041065846 8:54082140-54082162 TTAACTTTTGATCTGTGTGGTGG - Intronic
1041135283 8:54751379-54751401 TTTGTTTTTGAACTGTGTGGTGG + Intergenic
1041158986 8:55018168-55018190 TTTCCTTGTCATTTGTCTGGAGG - Intergenic
1041736199 8:61113436-61113458 GTTACTTTTGAGGTGTGTGGTGG + Intronic
1043910244 8:85855535-85855557 TTTGTTTTTGAGTTGTGTGGTGG + Intergenic
1044027322 8:87189534-87189556 CTTCCTTTTGTTGTTTGGGGAGG - Intronic
1044215328 8:89602769-89602791 TTTCCAGTTCATGTGTGTGCTGG + Intergenic
1044553757 8:93539885-93539907 TTTCCTTTTGCTGGTGGTGGGGG + Intergenic
1044683361 8:94804017-94804039 TTTCCTTTAGTTGGGTGTGGTGG - Intergenic
1045076660 8:98576865-98576887 TTTCATTTTGACCTGTCTGGTGG - Intronic
1045900319 8:107271074-107271096 TCTCCATTTCGTGTGTGTGGAGG - Intronic
1046226625 8:111289052-111289074 TTACCTGTTGATGTATGTGAAGG - Intergenic
1046269573 8:111876577-111876599 TTTCCTTTTGATGAATTTTGGGG + Intergenic
1046965073 8:120155100-120155122 TCTCCTTTTGATGACTGTGAGGG + Intronic
1047421530 8:124711696-124711718 TTTCTTTTTCATGTGGTTGGGGG - Intronic
1047925927 8:129682624-129682646 TTTCCTCTGGCTGGGTGTGGTGG - Intergenic
1048058409 8:130891806-130891828 TTTCCTTCTTATGGGAGTGGAGG + Intronic
1048557223 8:135491397-135491419 TTTCCTTTTTTTTGGTGTGGGGG - Intronic
1048821939 8:138388149-138388171 TTTCCTGGTGATGTGTGATGTGG - Intronic
1049215040 8:141403799-141403821 TTTGATTTTGAAGTGCGTGGTGG - Intronic
1049490309 8:142895599-142895621 TTTTCTTGTGATGTGTTTGTTGG + Intronic
1050864035 9:10475357-10475379 TTTCCAGTTGATTTGTGTAGAGG - Intronic
1051551988 9:18340011-18340033 CTTCCTGTTGATATGTCTGGTGG + Intergenic
1052456782 9:28709454-28709476 TTTACTTTGGATGTATTTGGGGG + Intergenic
1054869134 9:70033098-70033120 TTTCTTCTGGATGGGTGTGGTGG + Intergenic
1055355292 9:75431348-75431370 TTGCTTGTTTATGTGTGTGGAGG + Intergenic
1056193485 9:84207019-84207041 TATCTATTTGATGTGTGTAGAGG + Intergenic
1057310677 9:93941047-93941069 GTTCCTCTTGCTGTGTCTGGGGG - Intergenic
1057899327 9:98935956-98935978 TTTTCTTTGTGTGTGTGTGGTGG + Intergenic
1059951578 9:119468754-119468776 TTACTTTTTGGTGTGTGTTGGGG + Intergenic
1061757611 9:132826440-132826462 TTTTATTGTGTTGTGTGTGGTGG + Intronic
1061880679 9:133567429-133567451 TGTCCCTTGGATGTGGGTGGAGG + Intronic
1061897343 9:133655349-133655371 TTCCCTTTTGATGTCTGTGGTGG + Intronic
1062167989 9:135117963-135117985 TCTCCTTTTGAGGAGTGTGCTGG + Intronic
1062175747 9:135161676-135161698 TTTCTTTTTTTTGTGTGAGGAGG - Intergenic
1062251860 9:135601974-135601996 TTTGCATATGGTGTGTGTGGGGG - Intergenic
1185627623 X:1493586-1493608 TTTGCTTTTGTTTTGTGGGGAGG - Intronic
1185743781 X:2555213-2555235 TTTCCTTTTGAAGCTTGTAGAGG + Intergenic
1185860008 X:3569068-3569090 GGTGCTTTTGATGTGTGTGGTGG - Intergenic
1185950657 X:4429527-4429549 TTTCCTTTTCATGTGCCTGTTGG + Intergenic
1186181661 X:6979317-6979339 TGTCCTTCAGATGTGTGTGGAGG - Intergenic
1186526974 X:10257754-10257776 TTTTCCTTTGGTGTGTGTGTGGG - Intergenic
1187250171 X:17590818-17590840 TTTTCTTTGTATGTGTGTGTTGG - Intronic
1187452754 X:19413187-19413209 TTTCCATTTTGTGTGTGTGTGGG - Intronic
1188209238 X:27399643-27399665 TTTTCTTTAGATGCGTGTTGAGG - Intergenic
1188437852 X:30183040-30183062 TTTCCATTTGATGCAAGTGGAGG - Intergenic
1188618395 X:32188811-32188833 AATGCTTTTGATGTGTTTGGGGG - Intronic
1188864254 X:35295085-35295107 TTTGCTTTTGTTGTCTGTGCTGG + Intergenic
1189074373 X:37900839-37900861 TTTTGTTTTTTTGTGTGTGGAGG + Intronic
1189238112 X:39504195-39504217 TTTACTTTTGAAGAGTGTGTGGG - Intergenic
1189450941 X:41129800-41129822 TTTCCTTTTGGGGAGTGAGGGGG - Intronic
1191675969 X:63792915-63792937 TTTCCTTTTGAGGTCGGGGGAGG - Intergenic
1191848028 X:65563520-65563542 TCTTCTTTTGCTGGGTGTGGTGG + Intergenic
1192581338 X:72284682-72284704 TTTTCTTTTGTTGTCTGTGAAGG + Intronic
1193168008 X:78303450-78303472 TGTCCTTGTGAGGTGTGTGTGGG + Intronic
1193562429 X:83034961-83034983 TTTGCTTTCCATTTGTGTGGAGG - Intergenic
1194230138 X:91311665-91311687 TTTCCTTTTGATTTCTGTTTTGG + Intergenic
1194561099 X:95421648-95421670 TTTCCTTTTTGTAAGTGTGGAGG - Intergenic
1194810543 X:98382431-98382453 TTTCCTGGTGGCGTGTGTGGGGG - Intergenic
1195472758 X:105250954-105250976 TTTCATTTTAATGTAGGTGGAGG + Intronic
1195919776 X:109972061-109972083 TTTGTTTTGGCTGTGTGTGGGGG + Intergenic
1196088423 X:111711662-111711684 TTTATTTTTGAAGTATGTGGAGG + Exonic
1196339107 X:114575584-114575606 TTTCTTTTGTGTGTGTGTGGGGG - Intergenic
1197170339 X:123426914-123426936 TTTTCGTTTTCTGTGTGTGGGGG + Intronic
1197696853 X:129559200-129559222 TTTTCTTTTTTTGTGTGTGTGGG + Intronic
1197802719 X:130368393-130368415 TTTCTTTTGTGTGTGTGTGGGGG - Intronic
1197927477 X:131662156-131662178 TTTTCCTTTGATTAGTGTGGAGG + Intergenic
1197977882 X:132184728-132184750 TTTGATTTTGATGAGTGAGGTGG - Intergenic
1198061469 X:133049156-133049178 GTACTTTTTCATGTGTGTGGAGG + Intronic
1199730325 X:150625789-150625811 TTTTGTTTTCGTGTGTGTGGTGG + Intronic
1199794971 X:151185598-151185620 TTACATTTTGATATGTGTGGTGG - Intergenic
1200081803 X:153580684-153580706 TTGCCATTTGAGCTGTGTGGTGG + Exonic
1200760398 Y:7033205-7033227 TTTCCAGCTGATTTGTGTGGAGG - Intronic
1200761675 Y:7044633-7044655 TTTCCTTTTTTTGTGGGGGGCGG + Intronic
1200784287 Y:7245996-7246018 TTTCTTTTTGTTTTGTCTGGAGG + Intergenic
1201602040 Y:15741559-15741581 TTTTGTTTTTATGTGTGTGTGGG - Intergenic
1201636353 Y:16127273-16127295 TTTAATTTGGCTGTGTGTGGTGG - Intergenic
1201673376 Y:16550873-16550895 TTTCCTTTTGAACTGCATGGTGG - Intergenic
1202344632 Y:23908498-23908520 TCAGCTTTTGATGTCTGTGGGGG - Intergenic
1202375136 Y:24228448-24228470 TTTCCTTTTTCTGTGTGTATGGG - Intergenic
1202495644 Y:25441672-25441694 TTTCCTTTTTCTGTGTGTATGGG + Intergenic
1202526136 Y:25761585-25761607 TCAGCTTTTGATGTCTGTGGGGG + Intergenic