ID: 1073799518

View in Genome Browser
Species Human (GRCh38)
Location 10:107026066-107026088
Sequence ATTTCCTTTTGATGTGTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 557
Summary {0: 1, 1: 0, 2: 4, 3: 56, 4: 496}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073799518_1073799524 -4 Left 1073799518 10:107026066-107026088 CCCCACACACATCAAAAGGAAAT 0: 1
1: 0
2: 4
3: 56
4: 496
Right 1073799524 10:107026085-107026107 AAATCACAGGCATGGAGGTAAGG No data
1073799518_1073799523 -9 Left 1073799518 10:107026066-107026088 CCCCACACACATCAAAAGGAAAT 0: 1
1: 0
2: 4
3: 56
4: 496
Right 1073799523 10:107026080-107026102 AAAGGAAATCACAGGCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073799518 Original CRISPR ATTTCCTTTTGATGTGTGTG GGG (reversed) Intronic
901659872 1:10792345-10792367 ATTTCCATTTACTTTGTGTGCGG - Intronic
901747457 1:11383790-11383812 GTTTCCTTCTGATGTGTGGGAGG - Intergenic
903271708 1:22192630-22192652 ATGTCCTCTTTTTGTGTGTGTGG + Intergenic
903355252 1:22742416-22742438 TTTTCCTTTTGATCTGAGTGAGG - Intronic
906188244 1:43878181-43878203 ATTGCCTTTTCGTCTGTGTGTGG + Intronic
906773606 1:48508201-48508223 ATTTCCTTATAATGTCTTTGTGG + Intergenic
906773676 1:48508985-48509007 ATTTCCTTATAATGTCTTTGTGG - Intergenic
907105702 1:51880409-51880431 CTTGCTTTTTTATGTGTGTGTGG - Intergenic
907186827 1:52615960-52615982 ATTTCCTAGTGATCTGGGTGTGG - Intergenic
908966909 1:69776694-69776716 TTTTCATTTTGGGGTGTGTGTGG + Intronic
909263427 1:73525386-73525408 ATTTTGTTTAGATGTCTGTGTGG - Intergenic
909346521 1:74594382-74594404 GTTGACTTTGGATGTGTGTGTGG - Intronic
909472944 1:76049896-76049918 ATTTTTTTTTGTTGTATGTGTGG + Intergenic
909702225 1:78538871-78538893 ATTTCCTTTTGAACTGGGTAAGG + Exonic
910834711 1:91497129-91497151 TTTTTTTTTTGGTGTGTGTGTGG + Intergenic
910875877 1:91877315-91877337 ATTTTCTTTTTTTGTGTGTGTGG + Intronic
911506686 1:98761630-98761652 ATATCCTCTTGGTGTGTTTGTGG + Intergenic
911761269 1:101620072-101620094 ACTAACTTATGATGTGTGTGTGG + Intergenic
911781065 1:101879235-101879257 TTTTTCTTTTGATGTCTGTATGG + Intronic
911950622 1:104169798-104169820 ATTTCCTTGTGGTTTGTATGTGG - Intergenic
912051729 1:105537866-105537888 ATATTCTTTTGATGTGTGTGCGG + Intergenic
912312704 1:108640028-108640050 TTTTCCTTTTGGTGGGTTTGTGG + Intronic
912588258 1:110787341-110787363 GTTTCCTTTTGCTCTCTGTGTGG - Intergenic
912852217 1:113136877-113136899 AGTTCTTTTTTAGGTGTGTGAGG + Intergenic
912875455 1:113353666-113353688 ATGTCCCTCTGATGTGTGAGAGG - Intergenic
912931501 1:113967687-113967709 AATTGCTTTTGATGTCTGTTTGG + Intronic
913399276 1:118410577-118410599 ATTGCCCTTTTATGTATGTGTGG - Intergenic
915023456 1:152804456-152804478 TTTTGCATGTGATGTGTGTGAGG + Intronic
915381914 1:155449484-155449506 ATATTCTTTTGAAGTGCGTGTGG - Intronic
915414609 1:155731432-155731454 ATTTCTTTCTGAAATGTGTGAGG - Intronic
915782457 1:158567827-158567849 ATTTCTTTTTTGTGTGTGTGTGG - Intergenic
917183504 1:172325035-172325057 GTTTCTTCTTGGTGTGTGTGTGG - Intronic
917791442 1:178501726-178501748 ATTTCCTGCTGATGATTGTGTGG + Intergenic
917911959 1:179657690-179657712 ATTTATTTTTGTTGTTTGTGTGG + Intronic
919975792 1:202611328-202611350 ATTTTCATTTTGTGTGTGTGTGG + Intronic
920755952 1:208732632-208732654 ATTTACTTTGTATGTGTGTAGGG - Intergenic
920961526 1:210668301-210668323 ATTTCCTTTGGATATTGGTGTGG + Intronic
921289243 1:213640209-213640231 ATTTCCTTTTAATGCCTGTGAGG + Intergenic
921918411 1:220639849-220639871 ATATCCTGTTGATGAGTTTGTGG - Intronic
922932528 1:229401624-229401646 ATTTGCTTTTGATGTGGAAGTGG + Intergenic
922963360 1:229666808-229666830 ATTTTCTTTTGCTGTGTGGTGGG + Intergenic
923415512 1:233754759-233754781 ACATTCTTTTGATGTTTGTGGGG - Intergenic
924545852 1:245026623-245026645 ATTTCTTATTGAGGGGTGTGTGG - Intronic
1063084904 10:2807608-2807630 ATTTCCTTTGGATGTATATCAGG - Intergenic
1064160023 10:12937348-12937370 ATTTCCTTTTAGTATGTGTGCGG + Intronic
1064677043 10:17770802-17770824 ATGTCATTTTTATGTGTGTATGG + Intronic
1065105964 10:22385196-22385218 ATTTCCTTTGGATGGGTGTGGGG + Intronic
1065420578 10:25539338-25539360 CTTTCCTTGTTATGTGTGGGGGG + Intronic
1066252011 10:33643176-33643198 TTCTCCTTTTACTGTGTGTGGGG + Intergenic
1067340439 10:45397379-45397401 ATTTTCTTTTTTTGTGTATGTGG - Intronic
1067371309 10:45685607-45685629 TGTTCCTTTTTATGTTTGTGTGG + Intergenic
1067388474 10:45840544-45840566 TGTTCCTTTTTATGTTTGTGTGG - Intronic
1067417592 10:46116415-46116437 TGTTCCTTTTTATGTTTGTGTGG + Intergenic
1067445789 10:46344035-46344057 TGTTCCTTTTTATGTGTGTGTGG + Intergenic
1067503006 10:46823303-46823325 TGTTCCTTTTTATGTTTGTGTGG + Intergenic
1067512794 10:46909709-46909731 ATTTCCTGGTGATGTGAATGGGG + Intergenic
1067591590 10:47516707-47516729 TGTTCCTTTTTATGTGTGTGTGG - Intronic
1067638705 10:48024782-48024804 TGTTCCTTTTTATGTGTGTGTGG - Intergenic
1067649451 10:48142113-48142135 ATTTCCTGGTGATGTGAATGGGG - Intergenic
1067785662 10:49244139-49244161 ACTGGCTTTTCATGTGTGTGGGG + Intergenic
1067899119 10:50219470-50219492 ATATCCTTTTCACCTGTGTGAGG - Intronic
1068236567 10:54242042-54242064 ATTAACATTTGATGTGAGTGAGG + Intronic
1068861809 10:61855310-61855332 ATTTCCTTTTTATTTGGGTATGG + Intergenic
1069903268 10:71718078-71718100 CTTTCCTTTTCATGAGGGTGGGG + Intronic
1070067565 10:73052213-73052235 TTTTTATTTTTATGTGTGTGTGG - Intronic
1070399493 10:76040764-76040786 CTTTCCTTTTGGGGTGTGTGGGG + Intronic
1070584367 10:77750656-77750678 TTATCCTTTTGATGTCTGTAGGG - Intergenic
1071981637 10:91009507-91009529 ATTTGCTGTTGAGCTGTGTGTGG - Intergenic
1072454025 10:95560989-95561011 ATTTCCTTTTTTGGTGGGTGTGG - Intronic
1072615616 10:97047475-97047497 ATCTGCTTTTGATGGGTGAGGGG + Intronic
1072625755 10:97110418-97110440 CTTTCCTTTTGGTGTGTATTTGG - Intronic
1073706952 10:105995026-105995048 TTTTCCTCTTGTTGTGTGTAGGG - Intergenic
1073799518 10:107026066-107026088 ATTTCCTTTTGATGTGTGTGGGG - Intronic
1073812787 10:107169004-107169026 ATTTGCTTTTATTTTGTGTGTGG + Intergenic
1074075390 10:110119029-110119051 AAGTCCTTTTTGTGTGTGTGTGG + Intronic
1074493919 10:113962174-113962196 ATTTCTTTTTAATGTATTTGAGG + Intergenic
1075218139 10:120557018-120557040 ATTTCATTCTAATGTTTGTGGGG + Intronic
1075981785 10:126746621-126746643 CATTCCTCTTGCTGTGTGTGTGG - Intergenic
1077475254 11:2786089-2786111 ATTACCTTTTTATGTGACTGAGG + Intronic
1077789756 11:5425508-5425530 TCTTCCTTTGCATGTGTGTGTGG + Intronic
1079059866 11:17239170-17239192 ATTTATTTTTTGTGTGTGTGAGG - Intronic
1079597847 11:22273023-22273045 ATTTCATTTTGGGGGGTGTGGGG + Intronic
1080836933 11:35948028-35948050 TGGTCCTTTTGCTGTGTGTGTGG + Intronic
1081095513 11:38928904-38928926 TTTTTTTTTTGATGTCTGTGTGG - Intergenic
1081371296 11:42306937-42306959 ACTACTTTTTCATGTGTGTGAGG - Intergenic
1081676743 11:44974438-44974460 CTTTCCTTTTACTGTGTATGGGG + Intergenic
1084359868 11:68662165-68662187 CTTTGCTTCTGATGTGTGGGAGG + Intergenic
1084715733 11:70872407-70872429 CTTTCCTCTTCATGCGTGTGGGG - Intronic
1085231522 11:74975376-74975398 CTTTCATTTTAGTGTGTGTGAGG - Intronic
1086111211 11:83200694-83200716 ATTTTATTTTTTTGTGTGTGTGG + Intronic
1086933387 11:92718231-92718253 ATATACTTTTGGTGTGTGTGTGG - Intronic
1087429750 11:98038126-98038148 ATGTCCTCTTGGTGTGTGAGTGG - Intergenic
1087688269 11:101290011-101290033 ATATCCTTTTAGTGTGTGTGTGG - Intergenic
1088153347 11:106775060-106775082 ACTTTGTTTTCATGTGTGTGTGG + Intronic
1088624703 11:111721365-111721387 TTTTCATTTGGGTGTGTGTGTGG - Intronic
1090848866 11:130553405-130553427 ATGTGCTGTTGATGTGAGTGAGG - Intergenic
1092492479 12:8957984-8958006 ATTCCCTTTTGATGGGCGTTTGG + Intronic
1092663556 12:10767343-10767365 ATTCCCTTTGGATTTGTATGAGG - Intergenic
1092881728 12:12892175-12892197 CTTTTCTCTTGATGTGTGGGCGG + Intronic
1092935477 12:13358820-13358842 ATACCGATTTGATGTGTGTGTGG + Intergenic
1093849705 12:24020648-24020670 ATTTCCTTTTGTTCTTTGTTTGG - Intergenic
1093913113 12:24769585-24769607 ATTTTTTTTTTATGTGTGTAGGG + Intergenic
1094346655 12:29477288-29477310 ATTTTCCCTTGATGTGGGTGGGG - Intronic
1094797305 12:33990399-33990421 AATACTTTTTTATGTGTGTGTGG - Intergenic
1095375541 12:41523784-41523806 TATTCCTTTTGATCTTTGTGTGG - Intronic
1095641175 12:44486741-44486763 CTTGTCTTTTGATGTGTGTGTGG + Intergenic
1098010134 12:66042135-66042157 TTATCTTTTTGATCTGTGTGTGG + Intergenic
1098131787 12:67358809-67358831 AGTTCCTTCTGAGGTCTGTGAGG + Intergenic
1098922530 12:76315578-76315600 ACTATCTTATGATGTGTGTGGGG - Intergenic
1098933121 12:76444023-76444045 AATGTATTTTGATGTGTGTGGGG + Intronic
1099092830 12:78335305-78335327 AATTCCTTTTCCAGTGTGTGTGG - Intergenic
1099563671 12:84212140-84212162 ATTTCCTTTTATTGTTTGTTAGG - Intergenic
1100843607 12:98637951-98637973 ATTTCCTTTTTATGAGTCAGGGG + Intronic
1102529511 12:113536006-113536028 ATTTCCTTTTGTTCTGTGCAAGG - Intergenic
1102566020 12:113798060-113798082 ATTTCATATTTTTGTGTGTGTGG + Intergenic
1102968231 12:117145657-117145679 ATTTCCTTCTGATTTCTCTGTGG - Exonic
1103805383 12:123568527-123568549 ATTTTCTATTTTTGTGTGTGTGG - Intergenic
1104266860 12:127241727-127241749 ATTTTCTTTGGATGTGTTTTTGG - Intergenic
1104405450 12:128512854-128512876 ATTTTCTTGTTTTGTGTGTGTGG - Intronic
1105370619 13:19798724-19798746 ATATACTTTTTTTGTGTGTGTGG - Intergenic
1105946894 13:25197912-25197934 AATTTCTTTTTATGTGGGTGGGG + Intergenic
1106062464 13:26307962-26307984 TTTTCCTTTTGATGGATGTTTGG + Intronic
1106397983 13:29399829-29399851 ATTTCCTGTTGATTTGTTTATGG - Intronic
1106478522 13:30118615-30118637 ATTTCCTTCTGTTTTGTGTGTGG - Intergenic
1106659407 13:31782982-31783004 ATTTCTTATTTATGTGTGTTTGG + Intronic
1107752910 13:43588428-43588450 TTTTCCCTCTGATGTGAGTGTGG + Intronic
1107756285 13:43626151-43626173 ATTTCCTTTTGATGTCTGCAGGG + Intronic
1109413678 13:62007794-62007816 ATTTCCCTTGTATGCGTGTGGGG - Intergenic
1109652182 13:65343103-65343125 ATATCCTTTTGGTGTGTATGAGG - Intergenic
1109913000 13:68941481-68941503 ATTTTCTTCTTGTGTGTGTGTGG + Intergenic
1110834683 13:80070195-80070217 TTTTCCTTTTTATCTGTGTAAGG - Intergenic
1111366724 13:87256758-87256780 ATTTTATTTTTCTGTGTGTGTGG - Intergenic
1111398248 13:87696894-87696916 ATTTCCTTCTGATGTGTAGATGG + Intergenic
1111435932 13:88208168-88208190 ATTTCCTTTTCCTTTGGGTGAGG - Intergenic
1113231766 13:108219091-108219113 TTTTACTTTTCATGTCTGTGTGG - Intronic
1113658597 13:112087724-112087746 ATTTAATTTTCATGTGAGTGGGG + Intergenic
1113675658 13:112205243-112205265 GTTTCATTTTCTTGTGTGTGTGG + Intergenic
1113692543 13:112321858-112321880 ATTGCCTTTTTCTTTGTGTGAGG - Intergenic
1114695378 14:24622871-24622893 ATTTTTTTTTTATATGTGTGTGG + Intergenic
1114782455 14:25553322-25553344 TTGTCTTTTTGATGTGTGTGAGG + Intergenic
1115067359 14:29280401-29280423 ATTTCCTTTAGATGAGTGGCAGG + Intergenic
1115449340 14:33528150-33528172 ATTATCTTTTATTGTGTGTGTGG + Intronic
1115702242 14:35965201-35965223 AGTTCATTTTGATGGGGGTGGGG + Intergenic
1115766904 14:36632385-36632407 ATTTCCTTTTAAGATATGTGGGG + Intergenic
1116260902 14:42624690-42624712 ATTTCTTTTTTTTTTGTGTGTGG - Intergenic
1116283677 14:42944851-42944873 ATTGTCTTTTGATGTGTTAGTGG - Intergenic
1117303340 14:54449637-54449659 TTTACCATTTGATGTGTGAGTGG + Intergenic
1117557532 14:56901352-56901374 TTTTTTTTTTGGTGTGTGTGGGG - Intergenic
1117615878 14:57533120-57533142 AGTTCCTTTTAATATCTGTGGGG + Intergenic
1117673414 14:58131180-58131202 AATTCATTTTCATATGTGTGTGG - Intronic
1118109807 14:62705499-62705521 ATTTCATTTTCTTGTGTTTGTGG + Exonic
1118538672 14:66798280-66798302 TTTTCTTTTTTATGTGTGTTTGG + Intronic
1120067589 14:80061382-80061404 ATATCCTCTAGATATGTGTGGGG - Intergenic
1120445753 14:84593293-84593315 ATTTCCTTTTAATGTGACTCAGG + Intergenic
1120484005 14:85087243-85087265 CTTTCCTTGGAATGTGTGTGTGG - Intergenic
1120937809 14:89914976-89914998 ATTGCTTTTTTGTGTGTGTGTGG - Intronic
1120991250 14:90379390-90379412 TTTTCCTGGTGTTGTGTGTGTGG + Intergenic
1121207099 14:92178977-92178999 ATTTTCTAAAGATGTGTGTGAGG + Intergenic
1121988893 14:98535588-98535610 ATTTCCTCTTGATGTGGCTGTGG - Intergenic
1122225388 14:100273803-100273825 ATTCCCTATAGATCTGTGTGTGG - Intronic
1122675425 14:103408695-103408717 ATTTTCATTTCCTGTGTGTGCGG + Intronic
1123173901 14:106399714-106399736 ATTTTATTTTGATGTTGGTGGGG - Intergenic
1123182154 14:106480988-106481010 ATTTTATTTTGATGTTGGTGGGG - Intergenic
1202917206 14_GL000194v1_random:186559-186581 TTTTCTTTTTTTTGTGTGTGTGG - Intergenic
1202944751 14_KI270726v1_random:15742-15764 ATTTTATTTTGATGTTGGTGGGG + Intergenic
1124867698 15:33509452-33509474 ATTTATTTTGTATGTGTGTGAGG + Intronic
1126140644 15:45435294-45435316 ATTTCCTTCTGCTGGGTGTGGGG + Intronic
1126199459 15:45969393-45969415 ATTTCCTTTTGTTGTAAGTTGGG - Intergenic
1126563259 15:50067994-50068016 ATTTCATGTTCCTGTGTGTGGGG - Intronic
1127069688 15:55276816-55276838 ATTGCATTTTTGTGTGTGTGTGG - Intronic
1127182358 15:56435501-56435523 TTATCCTTTTGATGTCTGTAGGG - Intronic
1127231080 15:56996152-56996174 AATACCTTTTGATGTGTTGGGGG + Intronic
1127797667 15:62452309-62452331 ATTTCCTTTTGCATTGTGTAAGG + Intronic
1128348499 15:66872540-66872562 TTAGCCTTTTAATGTGTGTGAGG - Intergenic
1128608312 15:69054793-69054815 ATTACCTTTTCATGTGTGTGTGG + Intronic
1131540632 15:93272195-93272217 ATTTCTTTTTCATATCTGTGTGG - Intergenic
1131730858 15:95279416-95279438 ATTTCCCTTTGGTGTTTGTGGGG - Intergenic
1131764754 15:95663443-95663465 ATTTCCTCTTGCTGGGAGTGAGG - Intergenic
1131868406 15:96735902-96735924 ATTTCCATTTGATGTGGATTGGG + Intergenic
1132071217 15:98777967-98777989 TTTTGTTTTTGATGTGTGTACGG + Intronic
1132246719 15:100302406-100302428 ATTTCTTTTGGATATGTATGAGG + Intronic
1135262408 16:20992258-20992280 AAGTCCTTTTGATGTGAGTCCGG + Intronic
1135340215 16:21638951-21638973 ATTTCCTTTTGGTGTGGGTTTGG + Intronic
1135426176 16:22338670-22338692 TTTTCTTTCTGATGTGGGTGGGG - Intergenic
1135473229 16:22751023-22751045 TCATCCTTTTGATGTGTGGGAGG - Intergenic
1135885508 16:26302374-26302396 ATCTCCTTATAATGTGTGTATGG - Intergenic
1137517929 16:49165607-49165629 ATATCCATTTAATGTTTGTGGGG + Intergenic
1138773937 16:59697493-59697515 ATTTCTTTCTTGTGTGTGTGGGG - Intergenic
1138911861 16:61410539-61410561 TTTTTCTTTTTGTGTGTGTGGGG - Intergenic
1139087881 16:63610398-63610420 ATTTTATTATGATGTGTCTGTGG + Intergenic
1139331215 16:66192611-66192633 TTTTTTTTTTTATGTGTGTGTGG - Intergenic
1140020760 16:71236392-71236414 ATTTTCTGTTAATGTTTGTGTGG + Intergenic
1140864725 16:79050146-79050168 ATTTACTTCTCACGTGTGTGTGG + Intronic
1140997929 16:80279133-80279155 ATGTCCTTTTGAGGTGGGGGTGG + Intergenic
1141108383 16:81252216-81252238 TTTTTCTTTTCTTGTGTGTGTGG + Intronic
1142942166 17:3389235-3389257 ATTACCTCTGGATGTGGGTGGGG + Intergenic
1144416244 17:15050086-15050108 ATTTCCTTGTGCTTTGTGAGGGG + Intergenic
1144424507 17:15129253-15129275 ATATCATATTGGTGTGTGTGTGG + Intergenic
1144769879 17:17753514-17753536 ATTTTCTTTTGGTGTTGGTGAGG - Intronic
1144783857 17:17821281-17821303 GATTCCTTTTGTTCTGTGTGGGG - Intronic
1146413084 17:32605708-32605730 TTATCCTTTTAATGTCTGTGTGG - Intronic
1146419274 17:32667578-32667600 ATGTACTTTTTGTGTGTGTGTGG - Intronic
1146806644 17:35870260-35870282 ATTTGCTTTATCTGTGTGTGGGG - Intergenic
1147940230 17:44041639-44041661 ATTTTCTTTTGATCAGTTTGTGG - Intronic
1149636139 17:58170922-58170944 ATTTCCTTTTGGTGTGAGTCTGG + Intergenic
1149821723 17:59786364-59786386 ATTTTCCTATGAAGTGTGTGCGG + Intronic
1149853931 17:60062528-60062550 TTTTCCTCTTTATGTGTGTTTGG + Intronic
1150744415 17:67804884-67804906 TTTTCCTTTTACTGTGTCTGTGG - Intergenic
1150792858 17:68212872-68212894 TTTTCCTTTTACTGTGTCTGTGG + Intergenic
1150821006 17:68434317-68434339 GTCCCTTTTTGATGTGTGTGTGG - Intronic
1151647348 17:75442263-75442285 ATTAACTTTTCATGTGAGTGAGG + Intronic
1151988805 17:77560902-77560924 CTTTCCTTTTGCTGTTTGTGTGG + Intergenic
1153781160 18:8496072-8496094 ATTTCCTAGGGATGTGTGTCAGG - Intergenic
1155172816 18:23279686-23279708 AATTCCTTCTGAGGTCTGTGAGG - Intronic
1155176641 18:23306979-23307001 ATTTATGTGTGATGTGTGTGAGG + Intronic
1155783502 18:29870769-29870791 AATGCCTATTGATGTGTATGTGG + Intergenic
1155838920 18:30624186-30624208 ATATCCTTTTGAAATGTGAGGGG - Intergenic
1157960031 18:52143179-52143201 ATGGCCTTTTGAAGTGTGGGTGG - Intergenic
1158750588 18:60254880-60254902 TTGTCCTTTTAATGTGTCTGTGG + Intergenic
1159638488 18:70835530-70835552 ATTTCATTTTGATTTGCTTGTGG + Intergenic
1161880208 19:6944808-6944830 CTTTCCTTTTGCTATGTGTTAGG + Intergenic
1162456550 19:10788458-10788480 ATTGGCTTTTGCTGTGAGTGAGG + Intronic
1163200414 19:15763266-15763288 ATTGCCTTTTGACTTGTTTGAGG - Intergenic
1163715952 19:18872277-18872299 TTTGCCTTTTGAGGTGTGGGTGG + Intronic
1163887232 19:19977229-19977251 AGTGGCTTTTGATGGGTGTGGGG - Intergenic
1164010493 19:21199258-21199280 ATTTCCTCATGCTGTGTATGTGG - Intergenic
1165744618 19:38223385-38223407 ATTTCTTTGTGTTGTGTGTCTGG - Intronic
1166643754 19:44515928-44515950 TATTCCTTTTTTTGTGTGTGTGG - Intronic
925220257 2:2133745-2133767 ATTTCCCTTTCATGTGAGGGTGG - Intronic
925638112 2:5961422-5961444 TTTTCCTTTTGATGTGTTGTTGG + Intergenic
925809416 2:7684550-7684572 ATTTCCATTTCATGATTGTGTGG - Intergenic
925965270 2:9059882-9059904 ATATCCTCTTGGAGTGTGTGTGG - Intergenic
926881375 2:17548216-17548238 CTTTGGATTTGATGTGTGTGGGG - Intronic
926944518 2:18172304-18172326 ATTGCCTCTGTATGTGTGTGTGG + Intronic
927512469 2:23652973-23652995 ATTTCCTTTTGAAGTCTAGGAGG + Intronic
927825310 2:26304910-26304932 ATTTCCTTATGCTATGTATGCGG + Intergenic
928017491 2:27671402-27671424 GTTTGCTTTTCATGTGTTTGGGG + Intronic
928688374 2:33773669-33773691 ATTACATTATAATGTGTGTGTGG + Intergenic
928947661 2:36786391-36786413 AGTTCCTTTTGATGTTTGAAAGG + Intronic
928948529 2:36793309-36793331 ATTTCATTTTTAAGTGAGTGGGG - Intronic
930228025 2:48814097-48814119 GTTTTTTTTTTATGTGTGTGGGG + Intergenic
930312704 2:49761721-49761743 ATTTTCTTGTAATGTGTGTAAGG - Intergenic
930648951 2:53944750-53944772 ATTTCCATGTGGTGAGTGTGGGG + Intronic
930657759 2:54023204-54023226 TTTTACATTTTATGTGTGTGTGG + Intronic
930668500 2:54123444-54123466 CTTTCCTTTTTTTGTGTGTGTGG + Intronic
930671273 2:54153466-54153488 TTTTTTTTTTCATGTGTGTGTGG + Intronic
931222006 2:60296573-60296595 ATTTCCCTTCAATGTGTCTGAGG + Intergenic
931896141 2:66732020-66732042 ATTTTTTTTTTGTGTGTGTGTGG + Intergenic
932460374 2:71878422-71878444 GTTTCCTTCTGATGTGAGAGAGG + Intergenic
932604373 2:73155451-73155473 ATTTCTTTTTGATTTCTGTTTGG - Intronic
933610059 2:84424674-84424696 TTTTGCTTTTTGTGTGTGTGTGG + Intronic
934965024 2:98713994-98714016 ATTTACTTTTCATTTGTGTATGG + Intronic
935272801 2:101449613-101449635 ATTTCCATATGTTGAGTGTGAGG + Intronic
935428933 2:102951811-102951833 TTTTTATTTGGATGTGTGTGAGG - Intergenic
935544772 2:104389263-104389285 ATTTCCTTTGGATATATGTTCGG - Intergenic
936280315 2:111134277-111134299 ATTTCGTTTTGATATGTTTATGG + Intronic
936901734 2:117488793-117488815 ATTTCCTTTGGATGTATTTCTGG - Intergenic
938613814 2:132976877-132976899 ATATCATTTTTGTGTGTGTGTGG + Intronic
940346840 2:152637266-152637288 ATTTCCTTGTTTTGTATGTGGGG + Intronic
941414403 2:165201458-165201480 TGTTCCTTTTGATGTGAGTTAGG + Intronic
941641549 2:167994416-167994438 ATTTGTTTTTTGTGTGTGTGTGG + Intronic
941715561 2:168759712-168759734 AGTTCTTTATTATGTGTGTGGGG + Intronic
942375246 2:175329894-175329916 ATTTCGATTTGATGTTTCTGAGG - Intergenic
943563080 2:189486432-189486454 ATTTCATTTTCATTTGTGCGTGG + Intergenic
943936973 2:193931833-193931855 AATTTCTTTTGAAGTGTTTGAGG - Intergenic
944525973 2:200620068-200620090 ATTTCCATTTGAGATGTTTGGGG + Intronic
944916746 2:204368658-204368680 ATTTTCTTTTGATTTCTGGGGGG + Intergenic
945060226 2:205902413-205902435 ATTTCATTTTGATTGGAGTGTGG + Intergenic
945102677 2:206275643-206275665 ATTTCCTTTAGGTGGGGGTGGGG - Intronic
945115695 2:206406139-206406161 ATTTCCTTTGGGTGGGGGTGGGG + Intergenic
945181932 2:207100801-207100823 CTTTTCATTTAATGTGTGTGGGG - Intronic
945387535 2:209220760-209220782 CTTTCCTTTTCAGCTGTGTGTGG - Intergenic
945842023 2:214898557-214898579 ATTTCCACCTGAGGTGTGTGAGG + Intergenic
946258272 2:218463497-218463519 ATTACCTTTTGAGGAATGTGGGG + Intronic
946954892 2:224918628-224918650 ATGTACTTGTGGTGTGTGTGTGG + Intronic
947417251 2:229909379-229909401 ATTTTTTTTTTTTGTGTGTGTGG - Intronic
948418786 2:237839241-237839263 ATTTTCTTTTTTTGGGTGTGGGG + Intronic
948736547 2:240011439-240011461 ATTTCAGTTTGATTTTTGTGGGG - Intronic
949051856 2:241901940-241901962 CCTTCCTTCTGACGTGTGTGCGG + Intronic
1168886119 20:1257888-1257910 TTATCCTTTTAATGTCTGTGGGG + Intronic
1169751796 20:9002131-9002153 ATTGGTTTTTGGTGTGTGTGTGG - Intergenic
1169891686 20:10460386-10460408 TTTTCCTTTTGATGTTGGTTGGG + Intronic
1172322728 20:34009210-34009232 GTTTTGTTTTGGTGTGTGTGTGG + Intronic
1172423830 20:34841492-34841514 GTTTCCTTTTGATGGATGTTTGG - Intergenic
1173071775 20:39775133-39775155 ATTTCCTTTTCTTGTGTGCTAGG + Intergenic
1173100057 20:40078555-40078577 TTTTCTTTTTTGTGTGTGTGTGG + Intergenic
1173174383 20:40753320-40753342 ATTTCCTGTTCATGTGTCTGAGG - Intergenic
1173454757 20:43192957-43192979 CTGGCCTTTTGATGTGTGTCAGG + Intergenic
1174444963 20:50584584-50584606 AATACCTTTTCAGGTGTGTGTGG + Exonic
1174523693 20:51154878-51154900 TTTTTGTTTTGGTGTGTGTGTGG + Intergenic
1174928721 20:54789715-54789737 ATTTTATTTTTGTGTGTGTGTGG + Intergenic
1175009503 20:55720870-55720892 ATTTCCTTTTGAAGTCAGTTGGG - Intergenic
1176149745 20:63584253-63584275 ATTTCCTAATGATGTGTGATGGG - Intergenic
1178165679 21:29973373-29973395 ATTTGATTTTGATATGTGTCTGG - Intergenic
1178288439 21:31345646-31345668 TGTTCCTTTAGATGTGTTTGTGG - Intronic
1179238945 21:39572103-39572125 ATTTTCTTTTGAGGGGTGAGAGG + Intronic
1180712177 22:17846841-17846863 GTTTCCTTGTGGTATGTGTGGGG - Intronic
1181278428 22:21702108-21702130 ATTTTGTTTTGCTGAGTGTGTGG + Intronic
1181371489 22:22421792-22421814 ATTTCTTTTTGGTGTGGGTTTGG + Intergenic
1181374824 22:22448825-22448847 ATTTCCTTTTGCTGTGGGTTTGG + Intergenic
1181656553 22:24305434-24305456 ATGTTCTTTTTATGTGTGTCTGG + Intronic
1182259257 22:29061261-29061283 ACTTTCTTTTTTTGTGTGTGGGG + Intronic
1183158985 22:36098138-36098160 ATTCCCTTTGTGTGTGTGTGTGG + Intergenic
949096089 3:87568-87590 TATTCCTTTTTGTGTGTGTGGGG + Intergenic
949221577 3:1640178-1640200 TTTTCATTTTTGTGTGTGTGTGG - Intergenic
951048681 3:18069655-18069677 ACTACCTTTTGATGTATTTGGGG - Intronic
951644092 3:24867824-24867846 ATTTCCTTTTGTTGTTTTTGTGG - Intergenic
952087144 3:29837905-29837927 GTTTCCTTATGATGTGTGAAAGG + Intronic
952579489 3:34815545-34815567 ATTACCTTTTTATATATGTGTGG + Intergenic
952724297 3:36566931-36566953 ATATCCTTTTGATGTCTGCCAGG - Intergenic
953430486 3:42835789-42835811 ATTTCATTATGATATGGGTGTGG + Intronic
953831993 3:46307108-46307130 TTTTCCTTTTGATTTCTTTGGGG + Intergenic
953921210 3:46953132-46953154 ATTTCCTTGTGATGTCTTTTGGG - Intronic
954373386 3:50181942-50181964 ATTTACATTTGTTGTGTCTGTGG + Intronic
954919356 3:54176297-54176319 ATTTCCCTTTTATGTGTTTAAGG + Intronic
955252705 3:57300538-57300560 ATTTCCATTTGTGGTGTGTGTGG - Intronic
955510485 3:59675837-59675859 TATTTCTTTTGATGTGTATGAGG - Intergenic
956381931 3:68673522-68673544 AGTTCCTTTTGCTAAGTGTGTGG + Intergenic
957006443 3:74953667-74953689 TTTTTCTTTTCATGTTTGTGGGG - Intergenic
957341077 3:78897355-78897377 AATTGCTTTTGATGTGTTTATGG - Intronic
957541756 3:81580191-81580213 ATTTTATGTTGATGTGTATGAGG + Intronic
957633104 3:82743736-82743758 ACATCCTTTTGATGTCTTTGGGG - Intergenic
958772751 3:98445560-98445582 ATTCCCTTTTAATGGGTATGTGG - Intergenic
962481678 3:135803421-135803443 TTTTCCTTTTCCTCTGTGTGTGG + Intergenic
962758843 3:138489668-138489690 GTTTTCTTTTGATGTGTCTTTGG + Intergenic
963238004 3:142974488-142974510 ATTTTCTTTCCATGTGTGTAAGG + Intronic
964019970 3:151998157-151998179 ATTTCCTTTTGATGTCTATTTGG - Intergenic
964110432 3:153081882-153081904 ATTGCCTTTTTGTGCGTGTGTGG - Intergenic
964511468 3:157457115-157457137 ATTTTATTTGTATGTGTGTGTGG + Intronic
964825229 3:160818834-160818856 ATTTCTTTTTGATATGTTTTGGG + Intronic
964866030 3:161262402-161262424 TTTTTCTTTTTATGTGTGTCTGG + Intergenic
965902974 3:173666899-173666921 ATTTTCTTTTTATGTGAGTTAGG - Intronic
966139150 3:176734696-176734718 ATTTTCCTGTGATCTGTGTGGGG - Intergenic
966606741 3:181828590-181828612 TTATCCTTTTGTTGTCTGTGGGG + Intergenic
966648434 3:182272096-182272118 GTTTTGTTTTGATGTGTGTCGGG - Intergenic
967539902 3:190655047-190655069 AATTCTTTTTTCTGTGTGTGTGG - Intronic
967884450 3:194323566-194323588 ATTTGTTTTTGCTGTGTGTGGGG - Intergenic
968923266 4:3533381-3533403 ATTTCCTTTTTTTGCGTGGGGGG + Intergenic
968932082 4:3586437-3586459 ATTTGATTTTGTTGTGTGGGAGG + Intronic
970137125 4:12937236-12937258 CTTTGCTTTTGGTGTGTGTGAGG - Intergenic
970209336 4:13691768-13691790 TTTTCTTTTTGATGTATGTGGGG + Intergenic
971164019 4:24163543-24163565 ATTTCCCTTTGGTGAGTATGGGG - Intergenic
971601772 4:28600952-28600974 ATTTCAATTTTGTGTGTGTGTGG + Intergenic
972252231 4:37314262-37314284 TTTTTCTTTTGATGTCTGTCTGG + Intronic
973035884 4:45405517-45405539 ATTTTCTTTTGCTGTGTGTAAGG + Intergenic
974118993 4:57615024-57615046 TTTTCCTTTTGGTGTGGGTGTGG + Intergenic
974382807 4:61163024-61163046 ATTTCCTTTGGAAGTGTGAGGGG + Intergenic
974553819 4:63417399-63417421 ATGTCATTCTGATGGGTGTGTGG - Intergenic
974582784 4:63827467-63827489 GTTACCTTTTTCTGTGTGTGTGG - Intergenic
974846871 4:67362268-67362290 TTTACCATTTGATGTGTATGTGG + Intergenic
974948893 4:68563667-68563689 ACTTTCTTTTGATGTGAGTGAGG + Intronic
974957924 4:68666100-68666122 ACTTTCTTTTAATGTGAGTGAGG + Intronic
975034947 4:69668567-69668589 GTGTCCTTGTGATGTGTGTGTGG - Intergenic
975569217 4:75795882-75795904 ATTCGTTTTTGTTGTGTGTGGGG + Intronic
975662723 4:76703790-76703812 AATTCCTTTTGATTTATGTTGGG - Intronic
975749210 4:77505767-77505789 ATTGCCTTGTGATTTTTGTGGGG + Intergenic
977053275 4:92157055-92157077 ATTTCTTTTGTGTGTGTGTGTGG - Intergenic
977465060 4:97373523-97373545 GTCACCTTTTGGTGTGTGTGTGG - Intronic
977870019 4:102080479-102080501 AATTCATTTTTTTGTGTGTGTGG + Intergenic
979696750 4:123621434-123621456 ATTTCCTTTTCAGGCTTGTGGGG + Intergenic
980450668 4:132966569-132966591 ATTTCCTTTTAATGAACGTGTGG - Intergenic
981309461 4:143282600-143282622 ATTTCCTTTTAATCTGTCAGTGG - Intergenic
981388506 4:144159493-144159515 GTTTCCTTTTGAAGAGTGTCTGG + Intergenic
981576760 4:146213675-146213697 GTTTGCTTTTGTTCTGTGTGTGG + Intergenic
981735884 4:147949867-147949889 CTTTTCTTTTGCTGTGTGGGAGG + Intronic
982284798 4:153724041-153724063 ATTTCCTTCTGCTGTGTGGAAGG + Intronic
982772460 4:159409867-159409889 ATTTTCTTTTGCTGTCAGTGAGG + Intergenic
982981298 4:162139733-162139755 ATTTCCTTATAATGTATGTAAGG + Intronic
983918701 4:173320873-173320895 ATTTACTTTTCAACTGTGTGTGG + Intronic
984332411 4:178341589-178341611 ATTTCCTTTTGATATATTTCTGG - Intergenic
984414979 4:179446542-179446564 ATTTCCTTTAGATGAGTATGTGG + Intergenic
984629136 4:182040970-182040992 ATTTACTTTTGCTGTGACTGTGG + Intergenic
984855557 4:184192826-184192848 ATTTTCTTTTCATGTGCTTGTGG - Intronic
986007267 5:3678290-3678312 ATTTTCTACTGAAGTGTGTGTGG - Intergenic
986048814 5:4067760-4067782 ATCTCCATGTGATATGTGTGAGG - Intergenic
986108386 5:4684635-4684657 ATTTCACTCTGTTGTGTGTGTGG + Intergenic
986342023 5:6797622-6797644 ATATGCATTTGGTGTGTGTGAGG - Intergenic
987419170 5:17698273-17698295 CTTTCCTTTTGTTATGTATGAGG - Intergenic
987911357 5:24150550-24150572 ATTTGTTTTGCATGTGTGTGGGG + Intronic
988083176 5:26438715-26438737 TTTTCTTTTTGATGTGTCTTTGG - Intergenic
988114838 5:26873025-26873047 ATAACCTCTTGATGTGTGGGGGG - Intergenic
988572432 5:32382334-32382356 TTTTCTTTTTTGTGTGTGTGAGG - Intronic
989686160 5:44089816-44089838 ACTTCCAGTTGATGTGAGTGGGG + Intergenic
990394275 5:55359743-55359765 CTTTCCTTGTACTGTGTGTGTGG + Intronic
990585468 5:57207258-57207280 ATTTCCTTTGGAAGTGCGAGGGG - Intronic
990590730 5:57261047-57261069 AAATCCTTTTGATGTGTCTTGGG + Intronic
991403811 5:66281917-66281939 GTTTCAGTTTGTTGTGTGTGTGG - Intergenic
992332372 5:75730528-75730550 ATTTTTTTTTAATGTGTGTGTGG - Intergenic
992888150 5:81179613-81179635 ATTTACTATTTGTGTGTGTGTGG + Intronic
993436835 5:87906273-87906295 ATTCCATTTTTTTGTGTGTGTGG + Intergenic
993769869 5:91913991-91914013 GTTGGATTTTGATGTGTGTGGGG + Intergenic
994227953 5:97275865-97275887 CTTTCCTTTTGATGTTTCTTAGG + Intergenic
994241202 5:97423654-97423676 ACACCCTCTTGATGTGTGTGCGG - Intergenic
994925305 5:106110226-106110248 ATACCCTCTTGGTGTGTGTGTGG - Intergenic
994938732 5:106291241-106291263 ATTTCATTTGTATGTGTATGTGG + Intergenic
995027437 5:107440065-107440087 ATATCCTTTTAATGAGTGTGGGG - Intronic
995993870 5:118275892-118275914 ATTACCTTTTGATGTCTGAAAGG - Intergenic
996044640 5:118857210-118857232 CTTTCCTATTCATGTGTGTGGGG + Intronic
996557756 5:124796630-124796652 AGTTCCTTTTGCTCTCTGTGTGG + Intergenic
996999463 5:129741887-129741909 AATTTTTTTTGATATGTGTGTGG - Intergenic
998674906 5:144396310-144396332 TTATCCTTTTGATGTAAGTGAGG + Intronic
999218823 5:149958343-149958365 AGCTCCTTGGGATGTGTGTGTGG + Intergenic
1000494025 5:161955573-161955595 ATTTCCTTGTGATATTTGTCAGG + Intergenic
1000689002 5:164291309-164291331 ATTTGCTTTTCTTGGGTGTGGGG - Intergenic
1000920823 5:167135003-167135025 AGTACATTTTGAAGTGTGTGCGG + Intergenic
1001308443 5:170593440-170593462 ATTTACTTTGGAGGGGTGTGTGG + Intronic
1002798934 6:502830-502852 ATTTCGTTTTTTTGTGTGAGGGG - Intronic
1003942842 6:11045024-11045046 AGTTACTTTAGTTGTGTGTGTGG + Intergenic
1005205440 6:23397935-23397957 ACTTCATTGTGATGTGTGTAAGG + Intergenic
1005317946 6:24622264-24622286 TGTTCCTTTTGATCTGTGAGGGG - Intronic
1005645658 6:27835468-27835490 TTTTCCTTTACATGTGTATGTGG + Intergenic
1005863465 6:29919135-29919157 ATTTCCTATTGATGTATATGTGG - Intergenic
1005865860 6:29935717-29935739 GTTTCCTATTGATGTATATGTGG - Intergenic
1006206809 6:32351804-32351826 ATTAACTTTTTATGAGTGTGAGG - Intronic
1007024472 6:38556654-38556676 ATTATCTTTTTTTGTGTGTGAGG - Intronic
1008170845 6:48203568-48203590 TTTTCCTTTTCATGTCTTTGAGG + Intergenic
1009573602 6:65423109-65423131 ATTTAATTTTTATGTGGGTGAGG - Intronic
1009991716 6:70851456-70851478 ATTTCCCTTTGATGAGAGTATGG + Intronic
1010915786 6:81616976-81616998 ACTTTATTTTGGTGTGTGTGTGG - Intronic
1010934816 6:81848693-81848715 AATTCCTTTTGAGCTGTGAGTGG + Intergenic
1010982243 6:82381507-82381529 ATTTCCTTTTGGGCTATGTGGGG + Intergenic
1012029026 6:94035128-94035150 TTTTTCTTTTGATACGTGTGTGG + Intergenic
1012266194 6:97146291-97146313 TTTTCTTTTTTATATGTGTGAGG - Exonic
1014153289 6:118083539-118083561 ATTTGCTTTTAATATCTGTGAGG - Intronic
1014395120 6:120918154-120918176 ATTTCATTATGATGTGTTTGTGG - Intergenic
1014607279 6:123492643-123492665 ATTTCCTTTTCAATTTTGTGTGG - Intronic
1015232587 6:130933345-130933367 ATTTCTTTTTGAAGTGTATTTGG - Intronic
1015603197 6:134930307-134930329 ATCTCTATTTGATGTCTGTGAGG - Intronic
1015822190 6:137275045-137275067 GTTTACTTTAGAAGTGTGTGGGG + Intergenic
1016131540 6:140478745-140478767 GGTTCCTTTTGATGGCTGTGAGG + Intergenic
1016736526 6:147485749-147485771 ATTCCCTCTTGGGGTGTGTGTGG - Intergenic
1016904273 6:149133365-149133387 AGTTACTTTTGCTGCGTGTGAGG + Intergenic
1017009123 6:150050929-150050951 TTTTCCTGTTGATGAGTGTTTGG - Intergenic
1017519503 6:155189170-155189192 ATTTCCTGTTTATGAGAGTGAGG + Intronic
1017526357 6:155244564-155244586 ATTTCCTTGTGATTTATTTGTGG + Intronic
1017802297 6:157908123-157908145 TTTTCCTTTTTATGTCTGTCTGG + Intronic
1018543455 6:164909701-164909723 ATTTTCTTTTTATGTATGTTTGG - Intergenic
1020361160 7:7328179-7328201 ATTACCTTTTGTGGTGTGGGTGG - Intergenic
1020628960 7:10617492-10617514 GTTACCTTTTTGTGTGTGTGTGG - Intergenic
1021507914 7:21405570-21405592 ATTTACATTTGAAATGTGTGTGG - Intergenic
1021512880 7:21453412-21453434 ATTTCCTTTTCAATTGTGTCTGG - Intronic
1021614707 7:22489717-22489739 ATTGCCTTTTGAGGGCTGTGAGG - Intronic
1021793750 7:24232233-24232255 CTATCCTTTTAATGTCTGTGGGG - Intergenic
1021874201 7:25033212-25033234 ATGCCCTTTTGTTGAGTGTGTGG + Intergenic
1021936069 7:25632463-25632485 ATTTCCTTCTGTTGTTTGTGGGG - Intergenic
1023250523 7:38255565-38255587 ATTTCCTTTTATTTTGTGAGTGG + Intergenic
1023499171 7:40829853-40829875 ATATGCTTTTGGTGTCTGTGTGG - Intronic
1024124506 7:46278799-46278821 TTTTCCTTTCAATGTCTGTGAGG + Intergenic
1024293699 7:47826248-47826270 AGTGCCTTTGGAGGTGTGTGTGG + Intronic
1024333640 7:48180898-48180920 ATTTCCTTTTGTTTTGTTTGAGG - Intronic
1024432043 7:49300250-49300272 TTTTGCTTTTGTTGTGTGTTGGG + Intergenic
1026050395 7:66941762-66941784 GTTTCCTTTTGAGGTGTTGGGGG - Intronic
1028092538 7:86721398-86721420 ATTTCTTTTTTATTTGTGTCAGG - Intronic
1028997801 7:97120715-97120737 ATTAAGTTTAGATGTGTGTGAGG - Intronic
1029315703 7:99711367-99711389 CTTTCCTTTAGATATGTTTGAGG + Intronic
1030946888 7:115734677-115734699 ATGTCCTTTTTATGTGTGTGAGG - Intergenic
1031233912 7:119147041-119147063 ATTTTCATTTTGTGTGTGTGAGG - Intergenic
1031321232 7:120330920-120330942 ATTTCATTTAGATGTTTTTGTGG - Intronic
1031750555 7:125567421-125567443 ATATCATTTTTGTGTGTGTGTGG - Intergenic
1031775632 7:125905673-125905695 AGTTCCTTTTTATGGCTGTGTGG + Intergenic
1032822420 7:135536485-135536507 ATTTCCTTTTGACTTGGGTTAGG - Intergenic
1032833962 7:135656019-135656041 TTTTCTTTTTGATGTGTATGAGG + Intergenic
1033096367 7:138435020-138435042 AGTTGGTTTTGATGTGTGAGAGG - Intergenic
1033407774 7:141087313-141087335 ATTCCCTTCTGATGTGTAAGAGG + Intronic
1034380490 7:150688119-150688141 ATTTCCTTTTGTTTTGGTTGCGG + Intronic
1034442498 7:151093462-151093484 ATTTCATTTTAATGTGTTTAAGG + Intronic
1035450007 7:158971261-158971283 TCTTCCTTTTGCTGTGTGTGGGG + Intergenic
1037154287 8:15680757-15680779 ATATTCCTTTGATGTGTTTGAGG + Intronic
1037841143 8:22245877-22245899 ATTTACTTTTATTGTGTGTTTGG + Intronic
1038853499 8:31304472-31304494 ATTTCCTTTGGATATATGAGGGG + Intergenic
1039198120 8:35055124-35055146 ATTTCATTTGTGTGTGTGTGTGG + Intergenic
1039205460 8:35148178-35148200 CTTTCTTTTTTAAGTGTGTGAGG - Intergenic
1039516672 8:38139541-38139563 ATTTCCTTTTGGTGTGGGTTTGG + Exonic
1039768489 8:40658431-40658453 GTTCCCCTGTGATGTGTGTGTGG + Intronic
1040886622 8:52270412-52270434 TTTTCCCTTTTGTGTGTGTGTGG + Intronic
1041368897 8:57139231-57139253 ATTTATCTTTTATGTGTGTGTGG + Intergenic
1041497336 8:58501583-58501605 ATTTCCTATTGATGGATATGTGG + Intergenic
1041828095 8:62121328-62121350 ATTTCCTCTGCATGTGTGTGTGG + Intergenic
1041840302 8:62262475-62262497 AATTCTTTTTGATGTCTGTTGGG + Intronic
1042093471 8:65185329-65185351 ATTTTTTTTTGATGTGTGCATGG - Intergenic
1042532596 8:69831691-69831713 GTTTCCTTTTGATTTTTGTAAGG + Intronic
1042898772 8:73699848-73699870 TTTTTTTTTTGATGTGTGTTTGG - Intronic
1043854628 8:85250943-85250965 CTTTTCTTTTTTTGTGTGTGTGG + Intronic
1044665301 8:94628627-94628649 GTTTTATTTTGTTGTGTGTGTGG + Intergenic
1044699808 8:94955626-94955648 ATTTCCTTTTAATCTATTTGGGG - Intronic
1045428396 8:102089480-102089502 ATTTCTATATGTTGTGTGTGTGG + Intronic
1045635574 8:104184064-104184086 TTTTCCTTTTGTGGGGTGTGTGG - Intronic
1045825969 8:106398574-106398596 TTTTCCTTCTGGTGTGTGTAAGG + Intronic
1046474948 8:114730022-114730044 ATTTCCTTTTGATTTGGATAAGG - Intergenic
1046748443 8:117900752-117900774 ATTTCCTATTGCTGAATGTGTGG - Intronic
1046965072 8:120155099-120155121 ATCTCCTTTTGATGACTGTGAGG + Intronic
1047358149 8:124142669-124142691 AATGCCTTTTGATGGGTGGGTGG - Intergenic
1047740042 8:127799102-127799124 TTTTCCTTTTTGTGTGTGTGTGG + Intergenic
1048107225 8:131424745-131424767 ATTTGCATTTGATGTTTGGGGGG - Intergenic
1048397832 8:134031591-134031613 ATTTTCTTTTTGTGTGTGTGTGG + Intergenic
1048695995 8:137028736-137028758 ACTTCATTTTCATGGGTGTGTGG - Intergenic
1049185753 8:141251910-141251932 ATTTTCTTTGATTGTGTGTGGGG - Intronic
1049588874 8:143446151-143446173 ATTTTCTTGTGTGGTGTGTGCGG - Intronic
1050629924 9:7548207-7548229 ATTTCCTTTTAAAATGTGTTCGG + Intergenic
1050735740 9:8760713-8760735 ATCTCCCTTTGATGTTTCTGTGG + Intronic
1050756205 9:9007105-9007127 ATTTCCTTAAGATGTGTGGATGG - Intronic
1051281642 9:15447257-15447279 ATTTCCTTTTGTTTTATGGGAGG - Intronic
1051512377 9:17892759-17892781 ATATCCTTTTGGTCTGTTTGTGG - Intergenic
1052543517 9:29843150-29843172 CTTACCTTTTTGTGTGTGTGTGG + Intergenic
1052640780 9:31164261-31164283 ATTTCCATTTAATGTTGGTGAGG + Intergenic
1054141388 9:61533738-61533760 ATGTGGTTTTTATGTGTGTGTGG + Intergenic
1054458054 9:65445491-65445513 ATTTGATTTTGTTGTGTGGGAGG - Intergenic
1055406081 9:75974715-75974737 ATTTCTCTCTGTTGTGTGTGGGG + Intronic
1055650762 9:78404754-78404776 TTTTCCTTTGTGTGTGTGTGTGG + Intergenic
1055946112 9:81692606-81692628 ATTTTCTTTTGATGCATATGTGG + Intergenic
1055953218 9:81750083-81750105 ATTTCCTTTTCAAGTGTATTTGG - Intergenic
1056709849 9:88983297-88983319 GTATCCTTCTGATGTCTGTGGGG + Intergenic
1057637600 9:96784845-96784867 TTCTCCTTTTAATGTCTGTGAGG + Intergenic
1058355632 9:104081021-104081043 ATTTACATGTGTTGTGTGTGTGG - Intergenic
1059636235 9:116173615-116173637 ATTTGCTTTTGATGGGATTGAGG - Intronic
1061099337 9:128480382-128480404 GTTACCTTTTTGTGTGTGTGTGG + Intronic
1061380082 9:130250568-130250590 TTGTCCTTTTAATGTCTGTGGGG + Intergenic
1061456133 9:130699238-130699260 ACTTCCTTTTGAGATGTTTGAGG - Intronic
1062700237 9:137896932-137896954 TTGTCCTTTTGATGTCTGTAGGG + Intronic
1185745496 X:2569475-2569497 ATTTGCTTGGGCTGTGTGTGGGG + Intergenic
1185996471 X:4955948-4955970 GTTTCATTCTGATGTGTCTGTGG - Intergenic
1186272481 X:7903668-7903690 ATTTCCTTTGGAGGAGTTTGTGG - Intronic
1186526975 X:10257755-10257777 TTTTTCCTTTGGTGTGTGTGTGG - Intergenic
1186589607 X:10916272-10916294 ATTTCCTTTTTGTATGTGTATGG + Intergenic
1186749030 X:12602452-12602474 GTTTCCTTTGGAGGTGTCTGTGG + Intronic
1187225030 X:17367572-17367594 ATTCCATTCTGGTGTGTGTGTGG + Intergenic
1187452755 X:19413188-19413210 TTTTCCATTTTGTGTGTGTGTGG - Intronic
1187469723 X:19558347-19558369 ATTTCAACTTGATATGTGTGAGG - Intronic
1187847764 X:23558545-23558567 ATTTCCTTTGGTTCTGTGTCTGG - Intergenic
1188133988 X:26471555-26471577 ATTTCCTTTGGATGTGGGGGGGG + Intergenic
1188139324 X:26528951-26528973 ATTTTATTTTTTTGTGTGTGTGG - Intergenic
1188895683 X:35665612-35665634 ATTTCCTCTTGAATTTTGTGAGG - Intergenic
1189238113 X:39504196-39504218 CTTTACTTTTGAAGAGTGTGTGG - Intergenic
1189995990 X:46638559-46638581 TTATCCTTTTGATGTCTGTGGGG - Intronic
1190521618 X:51284173-51284195 ATTTCCTTTTTACCTTTGTGTGG - Intergenic
1191685834 X:63889579-63889601 ATTTTCTTTTTTTGTGTTTGTGG - Intergenic
1192279689 X:69671789-69671811 GTTTTGTTTTTATGTGTGTGTGG + Intronic
1192448820 X:71230131-71230153 TTTTCTTTTTTGTGTGTGTGTGG - Intergenic
1193168007 X:78303449-78303471 GTGTCCTTGTGAGGTGTGTGTGG + Intronic
1194337102 X:92661172-92661194 ATTTCCTTTTAATGGGTGGAGGG + Intergenic
1194479934 X:94408930-94408952 ATTTCCTTTTGGTATTTTTGTGG - Intergenic
1194865830 X:99065229-99065251 TTTTCCTTTTTTTGTCTGTGAGG - Intergenic
1195204334 X:102580597-102580619 ATACCCTCTTGCTGTGTGTGTGG - Intergenic
1195819442 X:108928210-108928232 TTTTCCTTTTGATGTCTGCAGGG + Intergenic
1195973766 X:110502430-110502452 ATTTCCATTTGATCAGTGTCTGG - Intergenic
1196387733 X:115176605-115176627 ATTTATTTTTTGTGTGTGTGTGG - Intronic
1196509066 X:116484015-116484037 ATTTCTTTTTTATGTGTCTTTGG - Intergenic
1196622633 X:117840827-117840849 ACTTCCTATTGATGAGTGGGAGG - Intergenic
1197696852 X:129559199-129559221 ATTTTCTTTTTTTGTGTGTGTGG + Intronic
1197716462 X:129710839-129710861 ATTTTCTTTTGATTGGTCTGTGG - Intergenic
1197878690 X:131141141-131141163 ATTTTCTTTTAAAGTATGTGGGG - Intergenic
1200645530 Y:5777911-5777933 ATTTCCTTTTAATGGGTGGAGGG + Intergenic
1201602041 Y:15741560-15741582 TTTTTGTTTTTATGTGTGTGTGG - Intergenic
1201731540 Y:17210096-17210118 AATTCCTTATGAGGTCTGTGAGG - Intergenic
1202035143 Y:20625536-20625558 ATTTCCTTTGTGTGTGTGTGTGG + Intergenic
1202375137 Y:24228449-24228471 TTTTCCTTTTTCTGTGTGTATGG - Intergenic
1202495643 Y:25441671-25441693 TTTTCCTTTTTCTGTGTGTATGG + Intergenic