ID: 1073799519

View in Genome Browser
Species Human (GRCh38)
Location 10:107026067-107026089
Sequence GATTTCCTTTTGATGTGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 293}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073799519_1073799523 -10 Left 1073799519 10:107026067-107026089 CCCACACACATCAAAAGGAAATC 0: 1
1: 0
2: 3
3: 30
4: 293
Right 1073799523 10:107026080-107026102 AAAGGAAATCACAGGCATGGAGG No data
1073799519_1073799524 -5 Left 1073799519 10:107026067-107026089 CCCACACACATCAAAAGGAAATC 0: 1
1: 0
2: 3
3: 30
4: 293
Right 1073799524 10:107026085-107026107 AAATCACAGGCATGGAGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073799519 Original CRISPR GATTTCCTTTTGATGTGTGT GGG (reversed) Intronic
901256449 1:7832184-7832206 CTTTTCCTTTTAATGTCTGTAGG + Intronic
902854124 1:19187540-19187562 GTTTTCCTTTTTCTTTGTGTAGG - Exonic
906113236 1:43338361-43338383 GATGTGCTTTGGATGTATGTGGG + Intronic
907086711 1:51682323-51682345 CATTTCCTTTGGATGTATGTTGG - Intronic
908220809 1:62004120-62004142 CATTGCCATATGATGTGTGTAGG - Intronic
908369367 1:63466393-63466415 GTTTTCCTTTAGAAATGTGTAGG - Intronic
908455341 1:64298246-64298268 GATTTCCTTTTCATGTCATTTGG - Intergenic
909001958 1:70228332-70228354 GTTTTACTTTTGAAATGTGTTGG + Intronic
909203222 1:72719648-72719670 GACCTCTTTTTTATGTGTGTTGG + Intergenic
909411909 1:75364113-75364135 GATTTTATTATGATGTGTCTTGG + Intronic
909590236 1:77340285-77340307 CATTTCCTTTTGTTCTGTGGAGG - Intronic
909975249 1:82038452-82038474 CATTTCATTTTGATTTGTCTAGG + Intergenic
910778380 1:90899518-90899540 GATTTCCTTTTAAACTGTGTGGG + Intergenic
911109952 1:94172998-94173020 CATTTCCTCTTGATTTGTCTGGG - Exonic
911451655 1:98069575-98069597 GATTCCCCTTTGATTTGGGTGGG - Intergenic
911939491 1:104023348-104023370 GATTTTCTTTTTATGAGTCTTGG + Intergenic
913123856 1:115767302-115767324 GATATACTTTTGATGTATTTGGG + Intronic
915201197 1:154230514-154230536 GATATGCTTTTGATTTGTTTTGG + Intronic
916962442 1:169902970-169902992 GATTTCCTTTAGCTGTTTCTTGG - Intergenic
919320327 1:196028539-196028561 GATTCCCTTTGAATTTGTGTAGG - Intergenic
920755953 1:208732633-208732655 AATTTACTTTGTATGTGTGTAGG - Intergenic
921253564 1:213319355-213319377 GAGTAACTGTTGATGTGTGTTGG + Intergenic
922630477 1:227103842-227103864 GCTTTCTTTTGGATGTTTGTTGG - Intronic
922963359 1:229666807-229666829 TATTTTCTTTTGCTGTGTGGTGG + Intergenic
923292188 1:232556999-232557021 AATTTACTTTTGTTGGGTGTGGG - Intronic
923518509 1:234717900-234717922 GATTTCCTTATGGTTTGTTTGGG - Intergenic
923625977 1:235614216-235614238 AATATCCTTTTTATGTATGTAGG + Intronic
923805733 1:237255999-237256021 AATTGCCTTTTGATGTGGTTTGG + Intronic
923868645 1:237966749-237966771 GATTTCTTTTTAATGTCTCTGGG + Intergenic
924023640 1:239810524-239810546 GATTTCCAAATGATGTGTTTAGG + Intronic
1064061804 10:12144144-12144166 GATTTTTTTTTGATGTTTTTAGG + Intronic
1065003665 10:21360528-21360550 TATTTTCTTTTGGAGTGTGTAGG + Intergenic
1065105963 10:22385195-22385217 CATTTCCTTTGGATGGGTGTGGG + Intronic
1065426407 10:25608920-25608942 GATCTTTTTTTCATGTGTGTTGG - Intergenic
1065653104 10:27915147-27915169 CATTTGATTATGATGTGTGTAGG - Intronic
1066042061 10:31558366-31558388 CATTTCATTATTATGTGTGTTGG - Intergenic
1067512793 10:46909708-46909730 GATTTCCTGGTGATGTGAATGGG + Intergenic
1067649452 10:48142114-48142136 GATTTCCTGGTGATGTGAATGGG - Intergenic
1069941110 10:71955942-71955964 CATTTCTTTTTTTTGTGTGTGGG + Intergenic
1070399492 10:76040763-76040785 ACTTTCCTTTTGGGGTGTGTGGG + Intronic
1070584368 10:77750657-77750679 ATTATCCTTTTGATGTCTGTAGG - Intergenic
1071046961 10:81391500-81391522 GATTTTATTATGATGTGTCTGGG + Intergenic
1072342427 10:94467005-94467027 GATTTCCTTATGACTTGAGTGGG + Intronic
1072644348 10:97240885-97240907 GGTTACCTCTGGATGTGTGTAGG + Intronic
1072948365 10:99831091-99831113 GATTCCATTCTGATGTGTGGAGG + Intronic
1073174531 10:101545225-101545247 AATTTGCTTATGATGTGTCTTGG + Intronic
1073576127 10:104626341-104626363 AATATCCTTTTGATGTCTGCAGG - Intergenic
1073706953 10:105995027-105995049 ATTTTCCTCTTGTTGTGTGTAGG - Intergenic
1073799519 10:107026067-107026089 GATTTCCTTTTGATGTGTGTGGG - Intronic
1074072328 10:110085249-110085271 TATTTCATTTTGAACTGTGTTGG - Intronic
1074290422 10:112133989-112134011 GAATTACTGTTGATGTGTTTAGG - Intergenic
1074290513 10:112134977-112134999 GAATTACTGTTGATGTGTTTAGG + Intergenic
1075946898 10:126440925-126440947 GAGTTCCTTTTCATGTGGGTAGG - Intronic
1075990031 10:126828107-126828129 GATTTCTTTTTCTTGTGTATTGG - Intergenic
1077990758 11:7409268-7409290 ATTATCTTTTTGATGTGTGTTGG + Intronic
1078567037 11:12424930-12424952 CATTTCCCTTTTCTGTGTGTAGG + Intronic
1080069426 11:28062111-28062133 GATTTCTTTTCAATGTGTGTAGG + Intronic
1080733898 11:34990432-34990454 AATTTCCTGTTGATGTATTTAGG + Intronic
1081729452 11:45359516-45359538 GATTTTCCTTACATGTGTGTTGG + Intergenic
1083142146 11:60730742-60730764 GATTTGATTTTGATTTGTTTGGG - Intronic
1086637640 11:89108516-89108538 AATTTCATTATGATGTGTATTGG - Intergenic
1087443736 11:98219134-98219156 GGTTTACTTTTCATGTGTGTAGG + Intergenic
1087880804 11:103414233-103414255 AATATCCTTTTAATGTCTGTAGG - Intronic
1088336376 11:108708849-108708871 TTTATCCTTTTGATGTCTGTGGG + Intronic
1089015894 11:115165012-115165034 GGTTTTGTTTTGGTGTGTGTGGG - Intergenic
1090146736 11:124332380-124332402 TATTTTCCTTTAATGTGTGTAGG - Intergenic
1091893212 12:4079173-4079195 GTGTTCTTTTTGATGTTTGTAGG + Intergenic
1092225858 12:6748080-6748102 AAGATTCTTTTGATGTGTGTGGG + Exonic
1093196186 12:16132085-16132107 GTTTTCCTTTTGAAGCATGTGGG + Intergenic
1093913112 12:24769584-24769606 AATTTTTTTTTTATGTGTGTAGG + Intergenic
1096350621 12:50896983-50897005 ATTTTCCTTTTAATGTCTGTAGG - Intergenic
1096925179 12:55135992-55136014 GCTTTCCTTAGGATGTGTTTGGG - Intergenic
1097107373 12:56633682-56633704 GTTTTCCTTGTGATGTGTTATGG - Intronic
1101263172 12:103055370-103055392 GTTATCCTTTTGATGTCTGAAGG + Intergenic
1101340709 12:103840463-103840485 GTTTTCCTTTTGGTGGGGGTGGG - Intronic
1101671737 12:106881753-106881775 TATTTCATTTTGATATTTGTGGG + Intronic
1101944374 12:109125103-109125125 TATGTCCTTTTTTTGTGTGTGGG + Intronic
1102836032 12:116061592-116061614 GATTTCATTCTGATTTGTGGTGG - Intronic
1103233653 12:119353342-119353364 GATTTCCTTTGGATCTGTGTTGG - Intronic
1103283435 12:119779804-119779826 AATTTTCTTTTGATGCTTGTAGG - Intronic
1103836707 12:123827198-123827220 GAGTTCCGTTTGATGTCTGCTGG - Intronic
1106706326 13:32283830-32283852 TTTCTCCTTTTGATGTGTGCAGG - Intronic
1106959509 13:34981883-34981905 GATATTCTTTTAATGTCTGTAGG + Intronic
1107595546 13:41960108-41960130 GAATTCTTTTTCTTGTGTGTTGG - Intronic
1107756284 13:43626150-43626172 AATTTCCTTTTGATGTCTGCAGG + Intronic
1108952163 13:56108304-56108326 TATTTCCTTTTGATGGTTTTAGG + Intergenic
1110714974 13:78691493-78691515 GATTTGCTTTTTATGTGTTTTGG + Intergenic
1111882833 13:93980083-93980105 GATTTCCATTTGTTGTGGGAGGG - Intronic
1112784015 13:102931635-102931657 GATTTCCATTTGATGTAACTCGG - Intergenic
1113430392 13:110245376-110245398 GTTTTCCTTTTGGTATCTGTAGG - Intronic
1113532379 13:111037699-111037721 GCTTACCTTTTCATGTGTGCAGG - Intergenic
1115766903 14:36632384-36632406 GATTTCCTTTTAAGATATGTGGG + Intergenic
1117032660 14:51690262-51690284 GATTACCATTTCATGTGTGTGGG - Intronic
1120406091 14:84094957-84094979 TATTTCTTTTTCATGTGTGTTGG + Intergenic
1122277221 14:100598917-100598939 GTTATCCTTTTCATGTCTGTGGG + Intergenic
1125136316 15:36348045-36348067 AATTTCCTTTACATGTATGTTGG + Intergenic
1125314404 15:38415739-38415761 GATTTTTTTTTCATGTTTGTTGG + Intergenic
1126140643 15:45435293-45435315 CATTTCCTTCTGCTGGGTGTGGG + Intronic
1126199460 15:45969394-45969416 CATTTCCTTTTGTTGTAAGTTGG - Intergenic
1127182359 15:56435502-56435524 ATTATCCTTTTGATGTCTGTAGG - Intronic
1127222709 15:56897004-56897026 GATTTGCTTTTGATATGGTTTGG + Intronic
1127349554 15:58136751-58136773 GATTTTGTATTTATGTGTGTGGG + Intronic
1129586667 15:76874623-76874645 GTTATCTTTTTGATGTGTGGAGG - Intronic
1130216429 15:81974653-81974675 TATTTCCTTTTGATATGGTTTGG - Intergenic
1130373342 15:83305959-83305981 GCTTTGCATTTAATGTGTGTAGG - Intergenic
1131730859 15:95279417-95279439 GATTTCCCTTTGGTGTTTGTGGG - Intergenic
1131868405 15:96735901-96735923 CATTTCCATTTGATGTGGATTGG + Intergenic
1131896095 15:97031153-97031175 ATTGTCCTTTTGATGTCTGTGGG - Intergenic
1131907576 15:97160265-97160287 TTTTTCCATTTAATGTGTGTAGG + Intergenic
1131953690 15:97708662-97708684 GATTTTCTTTTGAAGTGTTTGGG + Intergenic
1134875355 16:17693312-17693334 GTTTTCCTTTTGGTTTGTTTTGG - Intergenic
1135814000 16:25615482-25615504 GATTTCATTTTGCTGTGACTTGG + Intergenic
1135849057 16:25946006-25946028 GATTTCCTTTGGAAGTGACTAGG - Intronic
1136362364 16:29789183-29789205 GATGTCCTTTTTATGTCTATGGG + Intergenic
1137298131 16:47117316-47117338 AATTTGATTTTGATGTGTGCAGG + Intronic
1137785980 16:51138155-51138177 CATTTCCTACTGATATGTGTTGG - Intronic
1137890761 16:52159831-52159853 CATGTCATTTTGATGTTTGTTGG + Intergenic
1138608748 16:58106225-58106247 GAATTCCTTCTTAAGTGTGTGGG - Intergenic
1141332214 16:83121416-83121438 GATTTACTTTGGAGGTCTGTTGG + Intronic
1143458639 17:7085274-7085296 ATTATCCTTTTGATGTATGTAGG + Intergenic
1143778551 17:9216665-9216687 GATTTCCTTCTGCTCTGTGGAGG + Intronic
1144147075 17:12409147-12409169 GATTTTCTTCTGATGTGAGACGG - Intergenic
1144416243 17:15050085-15050107 GATTTCCTTGTGCTTTGTGAGGG + Intergenic
1144783858 17:17821282-17821304 GGATTCCTTTTGTTCTGTGTGGG - Intronic
1144951360 17:18995970-18995992 GATTTGTTTATGATGTGCGTTGG - Intronic
1149248695 17:54742465-54742487 CATTTCCTTTTTAAGTGGGTCGG - Intergenic
1149428149 17:56575261-56575283 CATTTCCTTTTATTGTCTGTGGG + Intergenic
1150302542 17:64058394-64058416 GATTTCCTTTTAATGTGAAATGG - Intronic
1151404088 17:73875702-73875724 GATCTCATTTTGAGGTGTTTGGG + Intergenic
1155838921 18:30624187-30624209 GATATCCTTTTGAAATGTGAGGG - Intergenic
1156423535 18:36982330-36982352 AATTTACTTTTGATGTGCTTTGG - Intronic
1157926511 18:51772654-51772676 AATTGCCTTGTGATATGTGTAGG - Intergenic
1158548300 18:58414342-58414364 ATTTTCCTTTTGATGTGAGCTGG - Intergenic
1159845085 18:73449397-73449419 TATTTACTTTTGATTTTTGTGGG + Intergenic
1161851635 19:6740502-6740524 GATTTCTTTTGGATGTGTAGTGG + Intronic
1162647423 19:12059912-12059934 GCTTTGGTTTTGATATGTGTAGG + Intergenic
1164163249 19:22644986-22645008 GAGCTTCTTTTCATGTGTGTTGG + Intronic
1164661633 19:29976633-29976655 GACTTCCTTTTTGTGTGTGTAGG - Intronic
1168209824 19:54882210-54882232 GAATTCTTTTTCATGTGTGGGGG - Intronic
927124610 2:20002590-20002612 CTTTTCCTTTTTGTGTGTGTGGG + Intronic
928634315 2:33227598-33227620 GATTTCCTCTTACTCTGTGTTGG + Intronic
928986637 2:37188734-37188756 GATTTCTTTTTCATGTGACTGGG - Intronic
929473022 2:42215477-42215499 CATTTTCTCTTGAAGTGTGTTGG + Intronic
929984453 2:46713479-46713501 TATTTCCTTTTTATGTCAGTAGG + Intronic
930340122 2:50102104-50102126 GATTTATTTTTGATGGCTGTAGG - Intronic
930631931 2:53762970-53762992 TATTTCCATTTTATTTGTGTAGG + Intronic
931111026 2:59111748-59111770 GTTTTGCTTTTGTTGTTTGTTGG - Intergenic
933011373 2:77068714-77068736 GATTGACATTTGAGGTGTGTTGG + Intronic
933147608 2:78873844-78873866 GATTTCCTTTTGAAGAGATTAGG - Intergenic
933632279 2:84671855-84671877 GATTTCCCTTTGATGTGATCAGG + Intronic
933860673 2:86464015-86464037 GACTTCCTTTTAATATCTGTTGG + Intronic
935119444 2:100170097-100170119 AATCACCTCTTGATGTGTGTTGG - Intergenic
935794063 2:106623779-106623801 CTTTTCTTTTTTATGTGTGTTGG + Intergenic
936051590 2:109227977-109227999 GATTTACATTTGCTGTGGGTAGG + Intronic
936107149 2:109634299-109634321 CATTTTATTATGATGTGTGTAGG - Intergenic
936578564 2:113675778-113675800 GCTTTCCTCTTGATGTGATTTGG + Intergenic
937192652 2:120119096-120119118 GATTTTTTTTTTATGTTTGTTGG + Intronic
937664765 2:124472970-124472992 TATTTCCTTTTAATTTGTGAGGG - Intronic
938783335 2:134604696-134604718 GCTTTCTTATTGATGTGTGGAGG - Intronic
940346839 2:152637265-152637287 GATTTCCTTGTTTTGTATGTGGG + Intronic
942040059 2:172051956-172051978 CATTTCCTTTTTATTTCTGTGGG + Intronic
942362007 2:175181923-175181945 GATTAACTTTTGATATGAGTTGG + Exonic
942956794 2:181782840-181782862 GAGTTCCCTTTGAAGTCTGTAGG - Intergenic
943500185 2:188678912-188678934 AATTTTCTTTTGGTGTGTTTTGG + Intergenic
943631943 2:190263668-190263690 GATTTACTTTTGATGTGTGAAGG - Intronic
946489102 2:220130622-220130644 GATTTCCTTCTCATTTCTGTAGG + Intergenic
947335382 2:229077152-229077174 GAGTTCTTTTTCATGTTTGTTGG + Intronic
947843831 2:233227771-233227793 TTTTTGCTTTTGATGTGTGGGGG + Intronic
1169891685 20:10460385-10460407 TTTTTCCTTTTGATGTTGGTTGG + Intronic
1171025918 20:21630328-21630350 GATGTTCATTTGAGGTGTGTTGG + Intergenic
1174136473 20:48383733-48383755 AATTTCATTTTGATTTGTGTAGG + Intergenic
1174234250 20:49075569-49075591 TATTTCTTTTTGACTTGTGTGGG - Intronic
1175009504 20:55720871-55720893 CATTTCCTTTTGAAGTCAGTTGG - Intergenic
1176149746 20:63584254-63584276 GATTTCCTAATGATGTGTGATGG - Intergenic
1176694024 21:9952020-9952042 GATTTCTTAATAATGTGTGTTGG + Intergenic
1180722638 22:17920748-17920770 GATTTCCATTTGGTGGGTGGTGG - Intronic
950533657 3:13567360-13567382 GATTTCCTTTTGTTTTGAGACGG + Intronic
953921211 3:46953133-46953155 TATTTCCTTGTGATGTCTTTTGG - Intronic
954053020 3:47997786-47997808 GATATGCTTTTAATGTCTGTAGG - Intronic
954892084 3:53939965-53939987 GATTTCATTTAGAGGTATGTAGG - Intergenic
955117030 3:56015966-56015988 GAGCTCTTTTTCATGTGTGTTGG + Intronic
955287534 3:57657631-57657653 GACTTCCTTTTGCTTTGTGGTGG - Intronic
956349947 3:68323382-68323404 GCTTTCCTTTACATTTGTGTTGG - Intronic
957789714 3:84924351-84924373 AATTTCGTTTTTTTGTGTGTGGG - Intergenic
959394599 3:105821519-105821541 GATTTCTTTTTGTTTTGTTTTGG - Intronic
959654489 3:108785999-108786021 GATTTCCTTTTCAGCTATGTTGG + Intergenic
960733654 3:120753819-120753841 GATTTGCTTTTGATGTTTCTGGG + Intronic
960800586 3:121535216-121535238 AATTTCATACTGATGTGTGTTGG - Intronic
961529389 3:127531188-127531210 GATTTCCTCTTGATTTCTGAAGG - Intergenic
961742844 3:129044957-129044979 AATATCCTTTTGATGTCTGTGGG - Intergenic
962822157 3:139059887-139059909 GATTTTTTTTTCATGTTTGTTGG + Intronic
964825228 3:160818833-160818855 CATTTCTTTTTGATATGTTTTGG + Intronic
965959325 3:174409876-174409898 GATTTCTTTTTTATGTCTTTAGG + Intergenic
966139151 3:176734697-176734719 GATTTTCCTGTGATCTGTGTGGG - Intergenic
966648435 3:182272097-182272119 TGTTTTGTTTTGATGTGTGTCGG - Intergenic
966965115 3:184983789-184983811 GGTTTGCTTTGTATGTGTGTGGG - Intronic
967884451 3:194323567-194323589 GATTTGTTTTTGCTGTGTGTGGG - Intergenic
970209335 4:13691767-13691789 ATTTTCTTTTTGATGTATGTGGG + Intergenic
970272914 4:14366483-14366505 GATTTCCCTTTGCTGTGTGAAGG - Intergenic
971164020 4:24163544-24163566 GATTTCCCTTTGGTGAGTATGGG - Intergenic
971997017 4:33977863-33977885 AATTTTATTTTGATGTGTATAGG - Intergenic
974134105 4:57792573-57792595 GCTTTCTTTTGGATGTGGGTGGG + Intergenic
974241370 4:59252796-59252818 CATTTCCTTTTAATGGGTGATGG + Intergenic
974382806 4:61163023-61163045 TATTTCCTTTGGAAGTGTGAGGG + Intergenic
975425122 4:74216352-74216374 GATTTAATTTTTATCTGTGTTGG - Intronic
975569216 4:75795881-75795903 GATTCGTTTTTGTTGTGTGTGGG + Intronic
975662724 4:76703791-76703813 AAATTCCTTTTGATTTATGTTGG - Intronic
976081083 4:81355730-81355752 GATTTCCTGTTGATGTCTGAAGG + Intergenic
978050669 4:104195502-104195524 ATTATCTTTTTGATGTGTGTTGG - Intergenic
978054502 4:104247210-104247232 CATTTCTTTTTGATGATTGTTGG + Intergenic
979793948 4:124820463-124820485 GCTGTACTTTTTATGTGTGTTGG + Intergenic
979987164 4:127329408-127329430 GTTTTCCTTTATGTGTGTGTAGG - Intergenic
980346398 4:131627117-131627139 GCTTTCCTTTATATGTTTGTTGG + Intergenic
980366647 4:131812213-131812235 GATTTCTTAATAATGTGTGTTGG + Intergenic
980828262 4:138097939-138097961 GTTGTGCATTTGATGTGTGTTGG - Intergenic
984485619 4:180365064-180365086 GATGTAATTTTGATGTGTGATGG + Intergenic
984578829 4:181486164-181486186 GCTTTCCTGCTGAGGTGTGTTGG - Intergenic
984738546 4:183136055-183136077 AATTTCTCTTTGATGTGTGTAGG + Intronic
985115480 4:186585843-186585865 GATTTCCTGCTGCTGTGTCTTGG - Intergenic
987056211 5:14195325-14195347 TATTTCCTTGTGATGTGGGTGGG + Intronic
987911356 5:24150549-24150571 GATTTGTTTTGCATGTGTGTGGG + Intronic
988053561 5:26061566-26061588 TATTTATTTTTCATGTGTGTTGG - Intergenic
989612138 5:43304706-43304728 ACTTTCCATTTGATGTATGTGGG - Intronic
989676106 5:43974802-43974824 GAACTCATTTTTATGTGTGTGGG + Intergenic
989686159 5:44089815-44089837 GACTTCCAGTTGATGTGAGTGGG + Intergenic
989796715 5:45483386-45483408 GAATTTTTTTTCATGTGTGTTGG + Intronic
990099520 5:52164287-52164309 TATTTCCTTCAGATTTGTGTAGG + Intergenic
990371585 5:55124726-55124748 GATTTTCTTTTTATATGTGAAGG + Intronic
990590729 5:57261046-57261068 AAAATCCTTTTGATGTGTCTTGG + Intronic
991505003 5:67315555-67315577 AATTTCCCTTTGTTGGGTGTAGG + Intergenic
991613746 5:68474871-68474893 CATTTTCTTTTAAGGTGTGTAGG + Intergenic
992260154 5:74961586-74961608 AATTTCTTATTGATTTGTGTAGG + Intergenic
993378584 5:87179571-87179593 AATTTCCTTTTGATATGGTTTGG + Intergenic
994208711 5:97064155-97064177 GATTTGCTTTAGAAGTGTGGTGG + Intergenic
994768111 5:103947012-103947034 CATTTTCTTTTTATGTGTTTTGG - Intergenic
995027438 5:107440066-107440088 GATATCCTTTTAATGAGTGTGGG - Intronic
995662729 5:114503132-114503154 TATTACCTTTTGATCTGTATAGG - Intergenic
996044639 5:118857209-118857231 ACTTTCCTATTCATGTGTGTGGG + Intronic
996802899 5:127422937-127422959 GATTTTTTGTTGATTTGTGTAGG + Intronic
996996477 5:129702376-129702398 ATTTTCCTTTTTATGTGTGTAGG - Intronic
997431825 5:133846114-133846136 AATTACTTTTTGATGTGTTTAGG - Intergenic
997786722 5:136720223-136720245 AATTTCCTTTTGTTGAATGTGGG + Intergenic
1000107346 5:158072875-158072897 GAGTTCCTGTTTCTGTGTGTGGG + Intergenic
1000689003 5:164291310-164291332 GATTTGCTTTTCTTGGGTGTGGG - Intergenic
1002977097 6:2091192-2091214 GATCTCCTTTTGATATGTGTTGG - Intronic
1003358596 6:5400221-5400243 GAATTCCTTTTCATGTGTTCAGG + Intronic
1004668086 6:17767587-17767609 TATTTCCTTTTGATTTAAGTTGG + Intronic
1005878569 6:30035332-30035354 AATTTCATTGTGATGTGTCTTGG + Intergenic
1008102795 6:47410419-47410441 GTTATCCTTTTGATGTCTGAAGG - Intergenic
1008268517 6:49462263-49462285 GATTTGTTTTTGAGGTGTGGGGG - Intronic
1008708165 6:54188786-54188808 GATTTCTTTTTCTTGTGTTTTGG - Intronic
1010336236 6:74686440-74686462 AATTTCATTATGATGTGTTTTGG - Intergenic
1012296551 6:97531843-97531865 GATTTCCTTTTGTATTGGGTTGG + Intergenic
1012381343 6:98623190-98623212 GATCTACTTTTTTTGTGTGTTGG + Intergenic
1012901716 6:105013871-105013893 GCTCTCCTTTTAATGTCTGTGGG + Intronic
1013026718 6:106281932-106281954 GAGTGCCTTTTCATGTTTGTTGG + Intronic
1013199964 6:107884418-107884440 AATTTTCTTTTAATGTCTGTTGG - Intronic
1017810911 6:157982465-157982487 GATTGCCCTTTGGTTTGTGTTGG + Intronic
1018384992 6:163294921-163294943 GGTTTCCCTTTGATGTTTGGTGG + Intronic
1019036709 6:169066698-169066720 AATTTCCTTTTGACTTGTTTTGG + Intergenic
1021793751 7:24232234-24232256 GCTATCCTTTTAATGTCTGTGGG - Intergenic
1021830942 7:24609224-24609246 GATTTCCTCTGTATTTGTGTAGG + Intronic
1021936070 7:25632464-25632486 TATTTCCTTCTGTTGTTTGTGGG - Intergenic
1022616920 7:31940960-31940982 GATTTCCTATTTGTGTGTGGAGG - Intronic
1022692704 7:32672765-32672787 GCTTTCCTTTTGCTGTTTGTGGG - Intergenic
1023221792 7:37926996-37927018 TATGTTCTTTTGATGTGTTTGGG + Intronic
1024432042 7:49300249-49300271 CTTTTGCTTTTGTTGTGTGTTGG + Intergenic
1024778560 7:52818534-52818556 ACTTTACTTTTGATCTGTGTAGG - Intergenic
1028032586 7:85934350-85934372 GTTTTGCTTTTGTTGTGTTTTGG + Intergenic
1028037036 7:85997815-85997837 TATTTCTTCTTCATGTGTGTTGG + Intergenic
1032619756 7:133517077-133517099 GAATTCCTTTTGCTCTGTGAAGG - Intronic
1032982868 7:137304899-137304921 AATTTCCTTTAGATGAGTGTTGG - Intronic
1033069292 7:138187402-138187424 GATTTTCTTTTGGTGTGATTAGG - Intergenic
1035320198 7:158024051-158024073 CAATTCCTCTTGATGTGTGAGGG + Intronic
1035450006 7:158971260-158971282 GTCTTCCTTTTGCTGTGTGTGGG + Intergenic
1036489987 8:9215898-9215920 GATTTGTTTCTCATGTGTGTTGG - Intergenic
1037440594 8:18912285-18912307 GATTTCCTTCAGATTTGTTTCGG - Intronic
1038048718 8:23789546-23789568 GATTTCCTATTGAGGTCAGTGGG + Intergenic
1039825754 8:41172852-41172874 GATTTCCTTTTTATTTTTCTGGG - Intergenic
1040600774 8:48881969-48881991 AATTTGCTTGTGATGTGTATTGG + Intergenic
1041306021 8:56461869-56461891 AATTTCCTTATAATGTGTCTTGG + Intergenic
1041331585 8:56731913-56731935 AATTTTCTTTTGTTGAGTGTAGG - Intergenic
1041840301 8:62262474-62262496 TAATTCTTTTTGATGTCTGTTGG + Intronic
1042609908 8:70587097-70587119 GCTTACCTTTTGAAGTGAGTTGG - Exonic
1043162411 8:76862431-76862453 GATTTCATTTTTAGGAGTGTAGG - Intronic
1043949739 8:86295008-86295030 ATTATCCTTTTGATGTTTGTAGG + Intronic
1048118637 8:131554500-131554522 AATGTGCTTTTTATGTGTGTAGG - Intergenic
1048466866 8:134672579-134672601 GATTTGATTATGATGTGTCTTGG - Intronic
1048504299 8:135006768-135006790 TATCTCCTTTTTATATGTGTAGG - Intergenic
1048964632 8:139606586-139606608 GTTTTCCTTTTGATGTTTTAAGG + Intronic
1052973336 9:34393693-34393715 GATTCCCATTAGATGTTTGTGGG + Intronic
1053631001 9:39938120-39938142 GATTTCTTAATAATGTGTGTTGG + Intergenic
1053774767 9:41525385-41525407 GATTTCTTAATAATGTGTGTTGG - Intergenic
1054212886 9:62312578-62312600 GATTTCTTAATAATGTGTGTTGG - Intergenic
1055387959 9:75784699-75784721 GATTAGCTTTTGATGTCTGCTGG + Intergenic
1057005318 9:91552361-91552383 GATTACCTTTCAATGTGGGTGGG - Intergenic
1059593848 9:115694352-115694374 GATTTCCTGTTGGTCAGTGTGGG + Intergenic
1059778984 9:117507246-117507268 TATTTCTTTTTCATGTGTGTGGG + Intergenic
1060223697 9:121777941-121777963 AACTTCCTTTTGATTCGTGTTGG + Intronic
1061567529 9:131452527-131452549 ATTATCCTTTTGATGTCTGTAGG + Intronic
1062626205 9:137443131-137443153 GTTATCCTTTTAATGTCTGTAGG + Intergenic
1062700236 9:137896931-137896953 ATTGTCCTTTTGATGTCTGTAGG + Intronic
1185950580 X:4428592-4428614 GATTTCCAGGTGATGTGTGGAGG - Intergenic
1186690917 X:11974692-11974714 GATGTGCTCTTGATGAGTGTAGG + Intergenic
1187414147 X:19077703-19077725 AATTTTCTTTTGATTAGTGTGGG - Intronic
1187867323 X:23735652-23735674 GATTTCCACTTCCTGTGTGTAGG - Intronic
1188133987 X:26471554-26471576 TATTTCCTTTGGATGTGGGGGGG + Intergenic
1188355538 X:29186103-29186125 GTTTTCATGTTGATGTGTGAAGG + Intronic
1188797837 X:34487526-34487548 CATTTCCTTTTCTTGTGTTTAGG + Intergenic
1188964116 X:36529694-36529716 TATGTCCTTTTGAAGGGTGTAGG - Intergenic
1189520525 X:41762638-41762660 GAATTCCTGTTTATGTGTGTTGG + Intronic
1189995991 X:46638560-46638582 GTTATCCTTTTGATGTCTGTGGG - Intronic
1190004642 X:46723696-46723718 GGATTCCTTATGGTGTGTGTGGG - Intronic
1190027329 X:46936544-46936566 GATTTTTTTTTTATGTTTGTTGG + Intronic
1191706209 X:64097061-64097083 GATTTACTTCTGATTTGTCTCGG - Intergenic
1192089934 X:68143416-68143438 GATTTCATTTTGTTGTCTCTTGG - Intronic
1192668410 X:73112341-73112363 TATTTCCTTCAGATTTGTGTAGG + Intergenic
1194052803 X:89092802-89092824 GATTTCTTTTTTTTGTTTGTTGG + Intergenic
1194337101 X:92661171-92661193 TATTTCCTTTTAATGGGTGGAGG + Intergenic
1195010137 X:100725381-100725403 TTTTTCTTTTTGATGTGTATTGG - Intronic
1195819441 X:108928209-108928231 ATTTTCCTTTTGATGTCTGCAGG + Intergenic
1197447819 X:126572910-126572932 GATTCCTTGTTGATGTGTATTGG - Intergenic
1197979013 X:132196278-132196300 GATTTCGTGTTGATGTAAGTTGG + Intergenic
1198143170 X:133826732-133826754 GGTTTCATTATGATGTGTCTAGG - Intronic
1199210551 X:145204949-145204971 CATTTGCTGTTGTTGTGTGTAGG + Intergenic
1199822874 X:151467533-151467555 GTTTTCCTTATTATGTCTGTCGG + Intergenic
1200645529 Y:5777910-5777932 TATTTCCTTTTAATGGGTGGAGG + Intergenic