ID: 1073799520

View in Genome Browser
Species Human (GRCh38)
Location 10:107026068-107026090
Sequence TGATTTCCTTTTGATGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 367}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073799520_1073799524 -6 Left 1073799520 10:107026068-107026090 CCACACACATCAAAAGGAAATCA 0: 1
1: 0
2: 1
3: 32
4: 367
Right 1073799524 10:107026085-107026107 AAATCACAGGCATGGAGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073799520 Original CRISPR TGATTTCCTTTTGATGTGTG TGG (reversed) Intronic
901252406 1:7790577-7790599 TGATTGCATTTTGAAATGTGAGG - Intronic
904967549 1:34389007-34389029 TATTTTTCTTTTGATGTCTGCGG + Intergenic
908023035 1:59917841-59917863 TCATTTCCTTTAGGTGTTTGTGG + Intronic
908456976 1:64313559-64313581 TGATTACCTTGTAATGTGTCAGG - Intergenic
909129247 1:71714385-71714407 TGATTTTGTTTTGAAATGTGAGG - Intronic
909884600 1:80925211-80925233 TGATTACATTTTGAGGTATGAGG - Intergenic
910246176 1:85140769-85140791 TTTTTTCCTTTTGATGTCTTTGG - Intergenic
910778379 1:90899517-90899539 TGATTTCCTTTTAAACTGTGTGG + Intergenic
911000094 1:93155504-93155526 TCATTTCCTTTGGTTGTGTGAGG - Intronic
911547616 1:99238420-99238442 TAAGTTCCTGTTGATTTGTGGGG - Intergenic
911830900 1:102550452-102550474 TGATTTTGTTTTAATATGTGAGG - Intergenic
913952779 1:143253619-143253641 TGAATTCCATTTGATGAGGGGGG + Intergenic
915751083 1:158212239-158212261 TGATATCCTTTTGATGGCAGTGG + Intergenic
915944954 1:160142819-160142841 TGATTTGCTTTTGACGTCTTAGG + Exonic
916577405 1:166079918-166079940 TGTTTTCCTTTTGTTACGTGTGG + Intronic
917649470 1:177062678-177062700 TGTTTTCCTTTTTATGGTTGTGG - Intronic
918563590 1:185898911-185898933 TGATTGCCATTTGATTGGTGTGG + Intronic
918654471 1:187007018-187007040 TGATTTCCTTGAAATGTATGAGG + Intergenic
919291249 1:195634412-195634434 TGATTATCTTTTGATATTTGTGG + Intergenic
920496295 1:206457194-206457216 TGATTTCCTTTTTCTGCTTGAGG - Intronic
920535664 1:206735005-206735027 TGATTGCTGTTTTATGTGTGAGG + Intergenic
922141901 1:222895490-222895512 TGATTTTCTTTTCCTTTGTGAGG + Intronic
922720888 1:227899812-227899834 TGTTTTCCTCTGGCTGTGTGAGG + Intergenic
923868644 1:237966748-237966770 TGATTTCTTTTTAATGTCTCTGG + Intergenic
924008070 1:239633999-239634021 TTATTTCCATTTTATGTATGAGG + Intronic
1063398561 10:5717775-5717797 TGATTTCCTTTTAAAGTTTAAGG + Intronic
1065105962 10:22385194-22385216 CCATTTCCTTTGGATGGGTGTGG + Intronic
1065561589 10:26969412-26969434 TGCTATGGTTTTGATGTGTGTGG - Intergenic
1067862449 10:49865879-49865901 TGATTTCCTTTTTAAATCTGTGG - Intronic
1068113706 10:52712446-52712468 TGATTTCCTCTTAATTTGTAAGG + Intergenic
1068263208 10:54611081-54611103 TTATTTCCTTTTGAGTTTTGTGG - Intronic
1068357922 10:55935411-55935433 TGATATATATTTGATGTGTGAGG + Intergenic
1069233738 10:66044346-66044368 TGATTTGCTTTTGATTTTTCTGG - Intronic
1069769047 10:70886162-70886184 TGATTTCCCTTGTGTGTGTGTGG - Intronic
1072342426 10:94467004-94467026 TGATTTCCTTATGACTTGAGTGG + Intronic
1073407292 10:103309160-103309182 TGATTGTCTTTTGAAATGTGAGG + Intronic
1073799520 10:107026068-107026090 TGATTTCCTTTTGATGTGTGTGG - Intronic
1074191452 10:111141213-111141235 TTATTTGTTTTTGATGTGTCTGG + Intergenic
1076369503 10:129942419-129942441 TGATTTGCTTTTGTTTTGTTTGG - Intronic
1076386310 10:130058473-130058495 TGATTTTGTTTTGTTTTGTGTGG - Intergenic
1079835084 11:25323829-25323851 TGATTGCATTTTGAATTGTGAGG + Intergenic
1080808322 11:35677098-35677120 TGTTTTCCATTTTATGTATGAGG + Intronic
1081769143 11:45636587-45636609 TGATTGCATTTTGAAATGTGAGG + Intergenic
1081782012 11:45719576-45719598 TGATTTCCTTCTGGTGGGAGGGG + Intergenic
1084706360 11:70818358-70818380 TGTTTCCCTGTTCATGTGTGAGG - Intronic
1084901231 11:72311448-72311470 TGATTTCCATTTTATAGGTGAGG + Intronic
1087286642 11:96271363-96271385 TGATTGTGTTTTGAAGTGTGAGG + Intronic
1088149415 11:106726110-106726132 TGATCTGCTTTTTATGTGTCAGG - Intronic
1088336375 11:108708848-108708870 TTTTATCCTTTTGATGTCTGTGG + Intronic
1088633912 11:111800684-111800706 TAATTACCTATTGATTTGTGTGG + Intronic
1088895954 11:114078554-114078576 TGATGTCCTTGTAATGTTTGCGG + Intronic
1089163726 11:116458911-116458933 TGATATCCATTAGATGTGTCAGG - Intergenic
1090158712 11:124468653-124468675 TGATTTCATTTTTAAGTTTGGGG - Intergenic
1090180345 11:124692847-124692869 TGAGTTCCTTTTTATGTCTCAGG + Intronic
1091244762 11:134082449-134082471 TAATTTCCTTGTAATGTGGGGGG + Intronic
1092807758 12:12241683-12241705 TGTATTATTTTTGATGTGTGTGG - Intronic
1093037943 12:14351119-14351141 TGATTGCATTTTGAAATGTGAGG - Intergenic
1093196185 12:16132084-16132106 TGTTTTCCTTTTGAAGCATGTGG + Intergenic
1093936718 12:25009392-25009414 TTATTTCCTTAGGATGAGTGGGG + Intergenic
1094194388 12:27731270-27731292 TGATGTGCTTTTGATTTGTCTGG + Intronic
1094570753 12:31639187-31639209 TCATTTCTTTTTTGTGTGTGTGG - Intergenic
1096820055 12:54226939-54226961 TCATTTCCTTTGGAAATGTGGGG - Intergenic
1096925180 12:55135993-55136015 TGCTTTCCTTAGGATGTGTTTGG - Intergenic
1097494236 12:60310095-60310117 TGATTTCCTTGTCATCTGTGTGG + Intergenic
1097721802 12:63029799-63029821 TAATTTGCTTTTGATGTTTCAGG - Intergenic
1097941821 12:65317134-65317156 TGATTTCCTTTTGAGGGCTTTGG + Intronic
1098051413 12:66457874-66457896 TGATCTCCATTTGACGTATGAGG - Intronic
1098947934 12:76608938-76608960 TGGTTTCCTGATGGTGTGTGGGG + Intergenic
1100843605 12:98637949-98637971 TTATTTCCTTTTTATGAGTCAGG + Intronic
1100916627 12:99431232-99431254 TGATTTCTGTTTTATCTGTGAGG - Intronic
1101340710 12:103840464-103840486 TGTTTTCCTTTTGGTGGGGGTGG - Intronic
1101944373 12:109125102-109125124 TTATGTCCTTTTTTTGTGTGTGG + Intronic
1102649154 12:114425070-114425092 TGATTTCCTTTGTAGGGGTGTGG - Intergenic
1103098759 12:118154111-118154133 TGATTCCCTCTTGATATGGGAGG + Intronic
1103182978 12:118930364-118930386 TGATTTTCTTTTTGTGTGTTGGG + Intergenic
1103696708 12:122821351-122821373 TGACTTCCCATTCATGTGTGGGG - Intronic
1106631421 13:31478727-31478749 TGATTTGGTTTTGAAATGTGAGG - Intergenic
1109368402 13:61389107-61389129 TGATTTTCTTTAGTTGTGTTAGG - Intergenic
1111268586 13:85851632-85851654 TGATTGCCTTTTAACTTGTGAGG - Intergenic
1111573530 13:90118818-90118840 TGATTTCCTTGAAATGCGTGAGG + Intergenic
1111882834 13:93980084-93980106 AGATTTCCATTTGTTGTGGGAGG - Intronic
1112061392 13:95742797-95742819 TGATTTCCTTTTTACTTCTGTGG + Intronic
1112996039 13:105575955-105575977 TGATTGCGTTTTGAAATGTGAGG + Intergenic
1113725316 13:112594843-112594865 TTATTTCTTTTTCATGTGTTTGG + Intergenic
1115886376 14:37976308-37976330 TGAATACTTTTTGATTTGTGTGG - Intronic
1116080357 14:40163192-40163214 TGATTTTGTTTTGAAATGTGAGG + Intergenic
1117032661 14:51690263-51690285 TGATTACCATTTCATGTGTGTGG - Intronic
1117070248 14:52049713-52049735 TTGTTTAATTTTGATGTGTGTGG + Intronic
1118405434 14:65418861-65418883 TCATTTCCTTTTGAGGTGGTAGG + Intronic
1119014270 14:71033142-71033164 TAATTTGCTTTTGATGCATGAGG - Intronic
1119456723 14:74762482-74762504 TGAATTCTTTTGGGTGTGTGGGG - Intergenic
1119552421 14:75524561-75524583 TCATTTCCATTTTATATGTGAGG - Intronic
1122277220 14:100598916-100598938 TGTTATCCTTTTCATGTCTGTGG + Intergenic
1123179431 14:106454672-106454694 TGATTTCTTTCTGCTGTGTTTGG + Intergenic
1123629065 15:22248364-22248386 TGATTCTGTTTTGAAGTGTGAGG + Intergenic
1124549734 15:30668850-30668872 TTTTTTTCTTTTGATGTGGGAGG - Intronic
1125262737 15:37846400-37846422 TAATTTCCTTAAAATGTGTGTGG + Intergenic
1127349553 15:58136750-58136772 TGATTTTGTATTTATGTGTGTGG + Intronic
1127485665 15:59415406-59415428 TAATTTCCTTTTGCTGGGTGCGG - Intronic
1127527865 15:59811708-59811730 TGTTTTGCTTTTGATCTGTAAGG + Intergenic
1127999593 15:64178420-64178442 TCATTTACTTTTGATGTATTGGG + Intronic
1128854456 15:70996469-70996491 TGATTTTCCTTTTATGTATGTGG + Intronic
1131118415 15:89808375-89808397 GGTTTTCCCTTTGATCTGTGTGG + Intronic
1131169526 15:90167561-90167583 TGATTTGCTTGTGAAATGTGAGG - Intronic
1131306567 15:91249237-91249259 TGATTTCCATTTGGTGACTGAGG - Intronic
1131703357 15:94965217-94965239 TGATTTCATTTATCTGTGTGTGG + Intergenic
1131730860 15:95279418-95279440 TGATTTCCCTTTGGTGTTTGTGG - Intergenic
1131896096 15:97031154-97031176 TATTGTCCTTTTGATGTCTGTGG - Intergenic
1131953689 15:97708661-97708683 TGATTTTCTTTTGAAGTGTTTGG + Intergenic
1132629663 16:911119-911141 TGATTTCTTTGTGAAATGTGTGG - Intronic
1133321008 16:4913923-4913945 TGATTTCCTCCTGGTCTGTGGGG - Intronic
1133933130 16:10248527-10248549 TGATTTTTTTTTTAAGTGTGTGG + Intergenic
1134673659 16:16074375-16074397 TCATTGCCTTATGATGTGAGGGG - Intronic
1134794555 16:17023121-17023143 TGATTTGCTTTTGTTATATGGGG + Intergenic
1135035567 16:19074173-19074195 TGACTGCCTTTTTTTGTGTGTGG + Intronic
1137904731 16:52309737-52309759 TATTTGCCTTTTGTTGTGTGTGG + Intergenic
1140563897 16:76017791-76017813 AGCTTTCCTTTTAATGAGTGTGG - Intergenic
1140740569 16:77937571-77937593 TGATTTCCTTGTAATGCTTGAGG + Intronic
1140886266 16:79246495-79246517 TGAGTTCCCTTTGATATGTTTGG + Intergenic
1141823230 16:86462235-86462257 TGTGCTCCTTTTAATGTGTGCGG + Intergenic
1141974998 16:87509894-87509916 TGATTGTGTTTTGAAGTGTGAGG - Intergenic
1144416242 17:15050084-15050106 GGATTTCCTTGTGCTTTGTGAGG + Intergenic
1144783859 17:17821283-17821305 TGGATTCCTTTTGTTCTGTGTGG - Intronic
1146171966 17:30641357-30641379 GGATTTCCTGTTCCTGTGTGGGG + Intergenic
1146345425 17:32057393-32057415 GGATTTCCTGTTCCTGTGTGGGG + Intergenic
1147412750 17:40265255-40265277 TGAGTACCTTTTTATGTGTCAGG + Intronic
1147490845 17:40864643-40864665 AGATTTCTGTGTGATGTGTGTGG - Intronic
1147866148 17:43553816-43553838 TGCTTTCCTCTTGCTTTGTGGGG + Intronic
1149195950 17:54121192-54121214 TGATTTCCTTATGATTTATGTGG + Intergenic
1150663702 17:67109758-67109780 TCATATCCTTTAGATGTGTTAGG - Intronic
1151902844 17:77028390-77028412 TGAGTTTCTTTTCATGTGTCAGG - Intergenic
1154383770 18:13875421-13875443 TTATCTCCATTTCATGTGTGAGG + Intergenic
1155838922 18:30624188-30624210 AGATATCCTTTTGAAATGTGAGG - Intergenic
1156273848 18:35562417-35562439 TTATTTCATTTTGACCTGTGAGG - Intergenic
1157108813 18:44800270-44800292 TCATTTCCTTTTGATGTTTGGGG + Intronic
1157332397 18:46713400-46713422 TGATCTCCTCTAGATGTCTGAGG - Intronic
1158166650 18:54547957-54547979 TGATTTTGTTTTTAAGTGTGAGG + Intergenic
1158871229 18:61690276-61690298 TGATTTCCTTTTGTTTTATATGG - Intergenic
1159265415 18:66073074-66073096 TGATTTTGTTTTGAAATGTGAGG - Intergenic
1159640746 18:70860240-70860262 TAATTTCCATTTGTTGTGAGAGG + Intergenic
1159845084 18:73449396-73449418 TTATTTACTTTTGATTTTTGTGG + Intergenic
1161727379 19:5937696-5937718 TGACTGCCTTTTCATGCGTGAGG + Intronic
1162990462 19:14298675-14298697 GGATTTCCTGTTCCTGTGTGGGG - Intergenic
1167711932 19:51117160-51117182 TGATCCCCTTTTGAAGTGTGTGG - Intergenic
1167840190 19:52110410-52110432 TGGTTTCATGTTGATGTTTGGGG - Intergenic
1168209825 19:54882211-54882233 AGAATTCTTTTTCATGTGTGGGG - Intronic
925129027 2:1481498-1481520 AGCTTTGCTTTGGATGTGTGTGG + Intronic
926464976 2:13176806-13176828 TGATTGCGTTTTGCTATGTGAGG - Intergenic
926662770 2:15486301-15486323 TCATTTTCTTCTGATGTGGGTGG - Intronic
927120760 2:19959849-19959871 TGATTTTCTTTTAATGTGTATGG - Intronic
927124609 2:20002589-20002611 TCTTTTCCTTTTTGTGTGTGTGG + Intronic
928226942 2:29457809-29457831 TGATTTCCTTCTCATGGATGAGG + Intronic
928986638 2:37188735-37188757 TGATTTCTTTTTCATGTGACTGG - Intronic
930512502 2:52363077-52363099 TTTCTTCCTTTTGATGTCTGTGG + Intergenic
931854203 2:66284568-66284590 TGTTTCATTTTTGATGTGTGTGG + Intergenic
933033794 2:77366597-77366619 GGATTTATTTTTGATGAGTGTGG - Intronic
933047856 2:77560494-77560516 TGAAATAGTTTTGATGTGTGTGG + Intronic
934971022 2:98764444-98764466 TCATTTCCTTTGGATGTGTATGG + Intergenic
936111441 2:109669156-109669178 TGATTTTATTTTCATGTATGAGG - Intergenic
936346470 2:111679263-111679285 TGCTTTCCTTTTGAGGCCTGGGG - Intergenic
936582496 2:113714940-113714962 TGAATTCCTTGAGATGTGTAAGG + Exonic
936816873 2:116470892-116470914 TAACTTCCTTTTGATATCTGGGG - Intergenic
937664766 2:124472971-124472993 TTATTTCCTTTTAATTTGTGAGG - Intronic
938409235 2:131050263-131050285 TGTTTCCATTTTGTTGTGTGGGG + Exonic
938900384 2:135794479-135794501 AGATTTCCTTGGGATCTGTGGGG + Intronic
939729391 2:145763230-145763252 TGATTCCCTATAGATATGTGAGG - Intergenic
939794507 2:146625472-146625494 TGTTTGCTTTCTGATGTGTGTGG - Intergenic
940426924 2:153540991-153541013 TGATTTTGTTTTGAAATGTGAGG + Intergenic
941058276 2:160813807-160813829 GGATGACCATTTGATGTGTGTGG + Intergenic
941551946 2:166927716-166927738 TGATTTCCCTTTGCCATGTGTGG + Intronic
941930230 2:170931011-170931033 TGGAATCCTTTTGATGTGTATGG - Intronic
944924077 2:204445436-204445458 TTGTTTGCTTATGATGTGTGTGG - Intergenic
945593837 2:211767878-211767900 TGATTACATTTTGAAATGTGAGG - Intronic
946817738 2:223596336-223596358 TGATTCTCTGTTGATGTGTTAGG + Intergenic
947334307 2:229066080-229066102 TTTTTTCCTTTTTTTGTGTGTGG - Intronic
947843830 2:233227770-233227792 GTTTTTGCTTTTGATGTGTGGGG + Intronic
1168995441 20:2129505-2129527 TGTTTTCCTTTTTATTGGTGGGG - Intronic
1169781316 20:9313904-9313926 TGATCTCCTTGTGGTGTGAGAGG + Intronic
1169858155 20:10125391-10125413 TAATTTCCATGTGTTGTGTGAGG - Intergenic
1170511825 20:17085496-17085518 AGTTTTCCTTTTGAGGTGAGGGG + Intergenic
1171290493 20:23980243-23980265 TGATTGTGTTTTGCTGTGTGAGG - Intergenic
1172701647 20:36856802-36856824 GGATTTCCTGTTTCTGTGTGTGG + Intronic
1173428279 20:42961755-42961777 AGAGTCCCTTTTGCTGTGTGAGG - Intronic
1174234251 20:49075570-49075592 TTATTTCTTTTTGACTTGTGTGG - Intronic
1174444345 20:50580384-50580406 TGAGTACCTATTGATATGTGTGG + Intronic
1174843226 20:53919229-53919251 TGATTTCAACTTGGTGTGTGAGG - Intergenic
1177439184 21:21098190-21098212 TTATTTCATTTTGATATTTGGGG + Intronic
1177933477 21:27315510-27315532 AGATTTCCTCTTGTTTTGTGGGG + Intergenic
1179019520 21:37625735-37625757 TGATTTCCTTTGCATGTGCATGG - Intronic
1181007865 22:20022628-20022650 TGATTACGTTTTGCAGTGTGTGG + Intronic
1181053895 22:20250504-20250526 TGGTTTCCTTTTCATTAGTGGGG - Intronic
1181703453 22:24633743-24633765 TGATTGTGTTTTGCTGTGTGAGG + Intergenic
1182799767 22:33022485-33022507 TGTTTTCCTGTTGATGTGGCTGG - Intronic
1182954770 22:34412542-34412564 TGATTCCTTTTTGAGGTTTGAGG - Intergenic
1183033709 22:35124742-35124764 TGCTATCCTTTTGATGAGTTTGG - Intergenic
949100931 3:144512-144534 TGATTTCATTTTATTGTGTTCGG + Intergenic
949408499 3:3739472-3739494 TGATTTCCTTTGGGTGTGAACGG + Intronic
949653874 3:6193866-6193888 TGATTTCCTTTAAATTTATGAGG - Intergenic
950068659 3:10134620-10134642 TGATTTCCTTGAAATGTATGAGG - Intergenic
951620458 3:24595823-24595845 TGTGTTCCTTATGATGTGTCAGG - Intergenic
952188049 3:30992345-30992367 TGATTGCGTTTTGAATTGTGGGG - Intergenic
952440279 3:33320370-33320392 TGATTTTTTTTGTATGTGTGAGG - Intronic
952682903 3:36116483-36116505 TGATTTCCTTTTGTTGGGGTGGG - Intergenic
953507786 3:43503330-43503352 TGATTTCTTGGTGATGGGTGGGG + Intronic
955095421 3:55792566-55792588 TGATTTCCATTTGTTGTCTATGG + Intronic
955693369 3:61611808-61611830 TCATATCCTTTTCATGTGTCAGG + Intronic
956264224 3:67379468-67379490 TGAGTTCCTTTGCATGTGTATGG + Intronic
957221932 3:77393992-77394014 AGATTTTGTTTTTATGTGTGCGG + Intronic
957527752 3:81399036-81399058 TATTTTCCATTTGATGTTTGAGG + Intergenic
957579629 3:82054540-82054562 TTATTCCCGTTTGATATGTGAGG + Intergenic
957789715 3:84924352-84924374 TAATTTCGTTTTTTTGTGTGTGG - Intergenic
958134307 3:89467809-89467831 TGATTTCTTTTTAATGACTGCGG + Intronic
959578590 3:107961510-107961532 TGATTACCATCTGAAGTGTGGGG - Intergenic
959617319 3:108362910-108362932 TGGCTTCCTTCTGAGGTGTGAGG - Intronic
960106522 3:113803689-113803711 TGATTTCCTTTTTTTATTTGAGG + Intronic
960733653 3:120753818-120753840 AGATTTGCTTTTGATGTTTCTGG + Intronic
960877159 3:122308713-122308735 TGATTTTCTTTTCATATGTTTGG + Intergenic
960880703 3:122341934-122341956 TGATTTAATTTTGAAGTATGAGG - Exonic
961742845 3:129044958-129044980 TAATATCCTTTTGATGTCTGTGG - Intergenic
962970406 3:140395710-140395732 TGATTACCTCTTGATGTGATTGG + Intronic
964128561 3:153262532-153262554 TGATTTACATTTGTTGTATGGGG + Intergenic
965023357 3:163264426-163264448 TGATTGTGTTTTGATATGTGAGG - Intergenic
966139152 3:176734698-176734720 TGATTTTCCTGTGATCTGTGTGG - Intergenic
966375839 3:179294632-179294654 TGCTTTTCTATTTATGTGTGGGG - Intergenic
966878503 3:184336741-184336763 TGATTTGTTTTTGCTGAGTGGGG - Intronic
966970130 3:185037886-185037908 TGCTTTCCTTTAGTTCTGTGAGG + Intronic
967385876 3:188910436-188910458 AAGTTTCCTTTTTATGTGTGTGG - Intergenic
967715208 3:192754449-192754471 TGTTATCCCTTTGATGTGTTAGG - Intronic
967884452 3:194323568-194323590 TGATTTGTTTTTGCTGTGTGTGG - Intergenic
968695741 4:2025409-2025431 TGATTGTGTTTTGAAGTGTGAGG - Intronic
968923264 4:3533379-3533401 TCATTTCCTTTTTTTGCGTGGGG + Intergenic
970055729 4:11969908-11969930 GGCCTTGCTTTTGATGTGTGGGG - Intergenic
970209334 4:13691766-13691788 TATTTTCTTTTTGATGTATGTGG + Intergenic
970291854 4:14581729-14581751 TGAAATCCTTTAAATGTGTGTGG + Intergenic
970304093 4:14713093-14713115 TGATTTTGTTTTTTTGTGTGTGG - Intergenic
970398664 4:15697074-15697096 TGACTTTATCTTGATGTGTGAGG - Intronic
970421331 4:15908163-15908185 TAATTCCCTTTTGCTGTGTAAGG - Intergenic
971486814 4:27169062-27169084 TAATTTTTTTTTGATGTGTGGGG + Intergenic
971540717 4:27813405-27813427 TGATTTCCTTGAAATGCGTGAGG - Intergenic
971887347 4:32469219-32469241 TGATTTACACTTGATATGTGAGG + Intergenic
972843156 4:42955241-42955263 TGATTTCTTTGAGATGGGTGAGG - Intronic
972952092 4:44339977-44339999 TGTTTTCTTTTTGATCTGTCTGG - Intronic
974134104 4:57792572-57792594 TGCTTTCTTTTGGATGTGGGTGG + Intergenic
974140395 4:57879352-57879374 TAATTGCTTTTTGGTGTGTGGGG - Intergenic
974306090 4:60142118-60142140 TGTTTTCCTTTTTTTTTGTGGGG - Intergenic
974329753 4:60463091-60463113 TGTTTTCATTTTAATTTGTGTGG - Intergenic
974382805 4:61163022-61163044 TTATTTCCTTTGGAAGTGTGAGG + Intergenic
974963521 4:68732227-68732249 TAATTTCCATGTGTTGTGTGAGG - Intergenic
974982188 4:68972198-68972220 TCATTTACTTTTGATTTGGGAGG + Intergenic
977100916 4:92814198-92814220 TATTTTACTTTTGATGTATGTGG + Intronic
978226461 4:106340545-106340567 TGATTTCCTGTTCCTGTGTTGGG + Intronic
978621822 4:110640373-110640395 TGATCTGATTTTAATGTGTGGGG + Intronic
979879057 4:125930948-125930970 TCATTTCTCTTTCATGTGTGAGG - Intergenic
981120625 4:141046942-141046964 TTTTTTCCTTTTGGTGTGTCGGG - Intronic
981343431 4:143648372-143648394 TGATTTTGTTTTGAAATGTGAGG + Intronic
981359733 4:143832282-143832304 TGATTTTGTTTTGAAATGTGAGG + Intergenic
981370490 4:143953357-143953379 TGATTTTGTTTTGAAATGTGAGG + Intergenic
981374806 4:144001990-144002012 TGATTTCCTGTTTGCGTGTGTGG - Intronic
981832893 4:149022427-149022449 TGATGTTCTTTTGAATTGTGAGG - Intergenic
981942380 4:150296260-150296282 TTATTTCCTTTGGGTGAGTGGGG - Intronic
982376703 4:154698934-154698956 TGATTTCCTTTTCATCTGAAAGG + Intronic
982468786 4:155760852-155760874 TGATTTCATTTTGTTGTCTCAGG + Intronic
982800568 4:159701544-159701566 TGATTTCATTATGATGTGTCTGG + Intergenic
982918713 4:161248176-161248198 TGATTTCCTTATTATTTCTGTGG - Intergenic
983104786 4:163673128-163673150 TTATTTCAGTTTGATGTATGTGG - Intronic
983230455 4:165124871-165124893 TGATTTCATTTTGATAGATGGGG - Intronic
983438780 4:167753981-167754003 TGATTTCATTTTTTTGCGTGAGG - Intergenic
984093125 4:175400367-175400389 TTTTTTCCTTTTGTTTTGTGTGG - Intergenic
984429425 4:179628933-179628955 TAATTTCCCTTTGAGGTTTGTGG - Intergenic
984429551 4:179630470-179630492 TGATTTCCTCAAGATTTGTGGGG + Intergenic
987056210 5:14195324-14195346 GTATTTCCTTGTGATGTGGGTGG + Intronic
987358852 5:17088579-17088601 AAATTTCCTTTTGCTGGGTGTGG + Intronic
987565496 5:19579366-19579388 TACTTTCCTTTTTATGTATGTGG + Intronic
988256734 5:28830425-28830447 TGATTGTCTTTTGAAATGTGAGG - Intergenic
989422461 5:41255642-41255664 TGATTGGCTTTTGATTTTTGTGG + Intronic
989676105 5:43974801-43974823 TGAACTCATTTTTATGTGTGTGG + Intergenic
989775542 5:45202438-45202460 AGATTTCCCTTTGGTGTGTATGG - Intergenic
990018555 5:51097707-51097729 TGAGTTCTTTTGGATGTTTGTGG + Intergenic
990103945 5:52232237-52232259 TTATTTCTTTTTGGTGTGTTTGG + Intergenic
991148688 5:63339412-63339434 TGATTTTCTTTTGAGGGGAGGGG - Intergenic
992988588 5:82259630-82259652 TGATTTCCTTTTAATTTATCAGG - Intronic
993216530 5:85030433-85030455 TGATCTCCTCTAGATGTGAGTGG + Intergenic
995027439 5:107440067-107440089 GGATATCCTTTTAATGAGTGTGG - Intronic
997786721 5:136720222-136720244 TAATTTCCTTTTGTTGAATGTGG + Intergenic
998473554 5:142402224-142402246 TGCCTTCCTATTGTTGTGTGAGG + Intergenic
999562225 5:152816435-152816457 CTATTTCTTTTTGATGTTTGTGG + Intergenic
1000107345 5:158072874-158072896 TGAGTTCCTGTTTCTGTGTGTGG + Intergenic
1000552902 5:162688726-162688748 TGACTTCCATTTTTTGTGTGTGG + Intergenic
1001100316 5:168808888-168808910 TGCTCTCCTTTTGATGTGGAAGG - Intronic
1001115198 5:168933584-168933606 TGATTCCCTTTTTAAGTATGAGG + Intronic
1001437034 5:171707434-171707456 TGATTTACTTTAGATCTGTTGGG - Intergenic
1002163602 5:177331718-177331740 TGATTTTGTTTTGTGGTGTGTGG - Exonic
1002407105 5:179043581-179043603 TGATTTCCTTGAAATGCGTGAGG + Intergenic
1002798936 6:502832-502854 TTATTTCGTTTTTTTGTGTGAGG - Intronic
1003810267 6:9771842-9771864 AGATTTGCTTTTGATTTCTGTGG - Intronic
1003855942 6:10275015-10275037 TGATTTCCCTTTCATTTCTGAGG - Intergenic
1004403830 6:15313158-15313180 TGATCTCCTTTTGATGGTTAGGG + Intronic
1004891415 6:20104447-20104469 AGTTTTGCTTTTGATGTTTGTGG + Intronic
1005103048 6:22194361-22194383 TCATTTCCTTTTTATCTGTCAGG - Intergenic
1006102380 6:31693527-31693549 TGGTTTCCCCATGATGTGTGGGG - Intronic
1006743153 6:36323468-36323490 AGATTTCCTTCTGCAGTGTGGGG + Exonic
1007600520 6:43077914-43077936 CGTTTTTCTTGTGATGTGTGTGG + Intronic
1008268518 6:49462264-49462286 TGATTTGTTTTTGAGGTGTGGGG - Intronic
1009691675 6:67042362-67042384 TGTTTTCTTTTTGTTTTGTGAGG + Intergenic
1009876524 6:69512433-69512455 TAATTTCCTTGTGTTGTGGGAGG + Intergenic
1009952984 6:70418077-70418099 TGAGTTCATTTTGATGAGTGAGG + Intronic
1010606051 6:77890618-77890640 TGATTTTGTTTTGAAATGTGAGG + Intronic
1011382828 6:86760747-86760769 TGATTGCATTTTGAAATGTGAGG + Intergenic
1011731988 6:90274325-90274347 TGTTTTGTTTTTGTTGTGTGTGG - Intronic
1011905881 6:92366670-92366692 TGATTCCCTTGTGTTGTGGGAGG - Intergenic
1012126061 6:95429131-95429153 TGATTACGTTTTGAACTGTGAGG + Intergenic
1012254534 6:97016671-97016693 TGATTGTGTTTTGAAGTGTGAGG + Intronic
1012901715 6:105013870-105013892 TGCTCTCCTTTTAATGTCTGTGG + Intronic
1014573381 6:123039635-123039657 TGTCTTCCTGTTGAGGTGTGTGG + Intronic
1016111097 6:140224996-140225018 TTATTTCCATTTTATGTGTGAGG + Intergenic
1016513059 6:144864678-144864700 TGATTTCCTCTTGAAATGTGAGG + Intergenic
1016781248 6:147961604-147961626 TGAATCTGTTTTGATGTGTGTGG - Intergenic
1016860359 6:148711852-148711874 TGAGTGCCTTTTGAAGTTTGTGG - Intergenic
1017640779 6:156491480-156491502 TGATTGTGTTTTGAAGTGTGAGG + Intergenic
1019023593 6:168939856-168939878 TGAACTGCTTTTCATGTGTGAGG + Intergenic
1019732620 7:2636237-2636259 TCATTTCCTTCTGATGAGTGGGG - Intronic
1020967272 7:14887098-14887120 TGATTTCCTGTTTATTTGTGTGG + Intronic
1021328031 7:19298575-19298597 TTCTTTCCTTATGATGTTTGAGG + Intergenic
1021577605 7:22118261-22118283 TGCTTTCTCTGTGATGTGTGTGG - Intronic
1021718013 7:23477719-23477741 TGATTTTGTTTTGGTGGGTGGGG + Intergenic
1021793752 7:24232235-24232257 TGCTATCCTTTTAATGTCTGTGG - Intergenic
1022692705 7:32672766-32672788 AGCTTTCCTTTTGCTGTTTGTGG - Intergenic
1023592912 7:41797777-41797799 TGATTGCCTTTGAATGAGTGAGG - Intergenic
1024014698 7:45302187-45302209 TTCTTTCTTTTTTATGTGTGAGG - Intergenic
1024185602 7:46945504-46945526 TGTTTTCCCTCTGATCTGTGGGG - Intergenic
1026050397 7:66941764-66941786 TTGTTTCCTTTTGAGGTGTTGGG - Intronic
1027556333 7:79669212-79669234 TAATTCCCATTTGTTGTGTGAGG + Intergenic
1027858932 7:83550334-83550356 TGAATTCCTGTGCATGTGTGTGG + Intronic
1029137010 7:98380561-98380583 TGATTTCCATGTGTTGTGGGAGG - Intronic
1030564142 7:111131189-111131211 TTAATTCCTATTGATTTGTGTGG - Intronic
1030745455 7:113160332-113160354 TCATCTCCATTTGAGGTGTGTGG + Intergenic
1032455503 7:132070491-132070513 TCATTTCCTTTTGCTATGTTTGG - Intergenic
1034874408 7:154712853-154712875 TGATTTTGTTTTGAATTGTGAGG - Intronic
1035320197 7:158024050-158024072 TCAATTCCTCTTGATGTGTGAGG + Intronic
1035450005 7:158971259-158971281 TGTCTTCCTTTTGCTGTGTGTGG + Intergenic
1036392528 8:8336696-8336718 TGATTTGCGTTTTATGGGTGGGG - Intronic
1037476780 8:19265466-19265488 TGATTTCCTCTTGAAGGGCGTGG + Intergenic
1037619815 8:20553776-20553798 TGATGTCCTTTTTCTGTTTGAGG + Intergenic
1038853497 8:31304470-31304492 TAATTTCCTTTGGATATATGAGG + Intergenic
1041579034 8:59435269-59435291 TGAATTCTTTTTGATGTAAGAGG + Intergenic
1041849962 8:62379377-62379399 TGATTTTGTTTTGATATGTGAGG + Intronic
1043144311 8:76632915-76632937 TGAATGACTTTTTATGTGTGTGG + Intergenic
1044056038 8:87570418-87570440 TGATTTTGTTTTGAAATGTGAGG + Intronic
1044253757 8:90035774-90035796 TAATTTTCTTTTGAGGTGTGTGG + Intronic
1045681206 8:104662325-104662347 TTATTTCCATTTGATGGATGAGG + Intronic
1046115133 8:109775858-109775880 TGGTTTCCTTGTGATGGGTTAGG + Intergenic
1046654380 8:116876582-116876604 TGATTTCCTTTTTTTTTGGGGGG - Intergenic
1046980559 8:120332053-120332075 TTAGTTCCTTTTCATGTTTGGGG - Intronic
1047059761 8:121212009-121212031 TCATTTCCTTGGAATGTGTGAGG + Intergenic
1047332154 8:123900450-123900472 TGACTTCCTTTTTATGGGTTTGG + Intronic
1047712928 8:127569921-127569943 TCATTTCCATTTTATTTGTGAGG + Intergenic
1047922059 8:129645418-129645440 TTATTTCCATTTTATGTATGAGG - Intergenic
1048431615 8:134376458-134376480 TGATTACCTTTTAATGTTGGGGG - Intergenic
1048624527 8:136170665-136170687 TGATTACTTTATGATGTGTGAGG + Intergenic
1049536457 8:143184636-143184658 TGATTCCCTGTGGGTGTGTGGGG - Intergenic
1051078291 9:13266189-13266211 TGATTTCCCTTTGCTGAATGTGG + Intronic
1052121631 9:24725010-24725032 TGATTCCCATGTGATGTGAGAGG + Intergenic
1052232617 9:26172886-26172908 TGATTTCCTTTTGCCTAGTGAGG + Intergenic
1052428725 9:28338475-28338497 TGATTGTCTTTTGAAATGTGAGG + Intronic
1053048609 9:34939990-34940012 TGATTTCCTTGAAATGTATGAGG - Intergenic
1054868212 9:70024891-70024913 TGATTACGTTTTGATAAGTGAGG - Intergenic
1055355291 9:75431345-75431367 TGATTGCTTGTTTATGTGTGTGG + Intergenic
1055705582 9:78997915-78997937 TTATTTCCTTGTGATGTCTTTGG + Intergenic
1056067895 9:82956061-82956083 TGATTTCCATATGTTGTGGGAGG - Intergenic
1056745167 9:89295408-89295430 TGATTTCCTTGAAATGCGTGAGG - Intergenic
1057554957 9:96080668-96080690 TGATTTCCTTACGATCAGTGAGG - Intergenic
1057870998 9:98717524-98717546 TGTGTTCCTTTTCATGTGTGAGG + Intergenic
1059593847 9:115694351-115694373 TGATTTCCTGTTGGTCAGTGTGG + Intergenic
1059778983 9:117507245-117507267 CTATTTCTTTTTCATGTGTGTGG + Intergenic
1059846923 9:118290242-118290264 TCCTTTCCTTCTGCTGTGTGAGG - Intergenic
1060990203 9:127844728-127844750 TGATTTTCATTTGATGTATCTGG + Intronic
1186733722 X:12438872-12438894 TGATTTCCATTTTATGGATGAGG + Intronic
1187140510 X:16588649-16588671 TGATCTCCTTTTTATTTCTGTGG - Exonic
1187414148 X:19077704-19077726 TAATTTTCTTTTGATTAGTGTGG - Intronic
1187880672 X:23844355-23844377 TAATTTCCCTTTGCTGTGTGAGG - Intronic
1188133986 X:26471553-26471575 CTATTTCCTTTGGATGTGGGGGG + Intergenic
1188892377 X:35626454-35626476 TGATCTGCTTTTTCTGTGTGTGG - Intergenic
1188930548 X:36104863-36104885 TTATTTCCATTTTATATGTGAGG - Intronic
1189312757 X:40031751-40031773 TGATTTCTTTTTGCTGAGAGGGG + Intergenic
1189995992 X:46638561-46638583 TGTTATCCTTTTGATGTCTGTGG - Intronic
1190004643 X:46723697-46723719 TGGATTCCTTATGGTGTGTGTGG - Intronic
1190071805 X:47285817-47285839 TGATTTCCTTGAAATGCGTGAGG + Intergenic
1194032640 X:88835557-88835579 TGATTTTGTTTTGAAATGTGAGG - Intergenic
1194805563 X:98323059-98323081 TGTTTTTCTTTTTATCTGTGTGG - Intergenic
1195532925 X:105977932-105977954 TGATTTCCTTGAAATGTATGAGG - Intergenic
1195580823 X:106500075-106500097 TGAAATCCTTTTCATGTGTTGGG + Intergenic
1196099824 X:111836185-111836207 TGATATCCTTTTGGTGTCTAGGG + Intronic
1197451778 X:126628581-126628603 TGATTTTGTTTTGATATGTGAGG - Intergenic
1197569255 X:128128920-128128942 TGATTTACTTTTGTAATGTGCGG - Intergenic
1197925404 X:131642071-131642093 TATTATCCTTTTGATGTCTGTGG - Intergenic
1199619517 X:149686729-149686751 TGATTTTGTTTTGAAATGTGAGG + Intergenic
1200759338 Y:7023268-7023290 TTGTTTCCTTGAGATGTGTGTGG + Intronic
1201385229 Y:13432968-13432990 GAATTTACTTTTGTTGTGTGGGG - Intronic
1201420819 Y:13796534-13796556 TTATTTCCTTTTCATGTGCAAGG - Intergenic
1201435868 Y:13958037-13958059 ACATTTCACTTTGATGTGTGTGG - Intergenic
1201745259 Y:17365260-17365282 CCATTTCCTTTTTTTGTGTGTGG - Intergenic