ID: 1073799521

View in Genome Browser
Species Human (GRCh38)
Location 10:107026072-107026094
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073799514_1073799521 7 Left 1073799514 10:107026042-107026064 CCATAGGTTGCAGGATTGAGATC 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1073799521 10:107026072-107026094 ACACATCAAAAGGAAATCACAGG No data
1073799511_1073799521 19 Left 1073799511 10:107026030-107026052 CCTGAAAATCCACCATAGGTTGC No data
Right 1073799521 10:107026072-107026094 ACACATCAAAAGGAAATCACAGG No data
1073799513_1073799521 10 Left 1073799513 10:107026039-107026061 CCACCATAGGTTGCAGGATTGAG 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1073799521 10:107026072-107026094 ACACATCAAAAGGAAATCACAGG No data
1073799509_1073799521 23 Left 1073799509 10:107026026-107026048 CCAACCTGAAAATCCACCATAGG 0: 1
1: 0
2: 0
3: 8
4: 98
Right 1073799521 10:107026072-107026094 ACACATCAAAAGGAAATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr